Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122627988:

Variant ID: vg1122627988 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22627988
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTTTAGTATCGGTTCTAAAAGTCCAAGTCGCAAAAACATCTTTAGTTTCGGTTGATGTCACCAACAATCTTTAGTATTGGTTGGTAACACCAATCC[G/A]
GACTAAAACTATTTTTAGTATCGATTGGTATGTCTCAAAGGTTAGTTAAAAAAACAAAGCAGCTCCATCTAAGTCAGATGTGTGTGGTAGATAGAATGGT

Reverse complement sequence

ACCATTCTATCTACCACACACATCTGACTTAGATGGAGCTGCTTTGTTTTTTTAACTAACCTTTGAGACATACCAATCGATACTAAAAATAGTTTTAGTC[C/T]
GGATTGGTGTTACCAACCAATACTAAAGATTGTTGGTGACATCAACCGAAACTAAAGATGTTTTTGCGACTTGGACTTTTAGAACCGATACTAAAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	20.70%	0.44%	17.52%	NA
All Indica	2759	48.00%	31.70%	0.40%	19.90%	NA
All Japonica	1512	92.50%	2.60%	0.46%	4.43%	NA
Aus	269	17.50%	13.80%	0.37%	68.40%	NA
Indica I	595	84.50%	10.30%	0.34%	4.87%	NA
Indica II	465	11.40%	59.40%	0.00%	29.25%	NA
Indica III	913	49.10%	24.10%	0.44%	26.40%	NA
Indica Intermediate	786	40.70%	40.50%	0.64%	18.19%	NA
Temperate Japonica	767	94.90%	3.70%	0.65%	0.78%	NA
Tropical Japonica	504	87.90%	1.40%	0.40%	10.32%	NA
Japonica Intermediate	241	94.60%	1.70%	0.00%	3.73%	NA
VI/Aromatic	96	85.40%	2.10%	0.00%	12.50%	NA
Intermediate	90	50.00%	30.00%	2.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122627988	G -> A	LOC_Os11g38150.1	upstream_gene_variant ; 3637.0bp to feature; MODIFIER	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N
vg1122627988	G -> A	LOC_Os11g38170.1	upstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N
vg1122627988	G -> A	LOC_Os11g38170.2	upstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N
vg1122627988	G -> A	LOC_Os11g38160.1	downstream_gene_variant ; 409.0bp to feature; MODIFIER	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N
vg1122627988	G -> A	LOC_Os11g38160-LOC_Os11g38170	intergenic_region ; MODIFIER	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N
vg1122627988	G -> DEL	N	N	silent_mutation	Average:43.028; most accessible tissue: Callus, score: 66.232	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122627988	3.56E-06	3.57E-06	mr1336	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	NA	7.01E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	5.00E-06	5.00E-06	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	NA	3.37E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	NA	3.35E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	NA	4.88E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122627988	NA	2.82E-11	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251