Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122614316:

Variant ID: vg1122614316 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 22614316
Reference Allele: C	Alternative Allele: T,CAA
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCTGTTTGTTCATCCTAGAGAGGTCTCGACATGGTTCGAATAACATGGCTATTGATGTGGCATACTGCAGGCATCATCATAGAACAAATAATCATGTA[C/T,CAA]
ATTTTTTTTCTTGAGAACCCATATGCATGCCTCTTCACATTTAAAATAAAGACAAAATTGGTTTTATAGCATCAAACGTTTGTGATTTTTGTATGTTAGC

Reverse complement sequence

GCTAACATACAAAAATCACAAACGTTTGATGCTATAAAACCAATTTTGTCTTTATTTTAAATGTGAAGAGGCATGCATATGGGTTCTCAAGAAAAAAAAT[G/A,TTG]
TACATGATTATTTGTTCTATGATGATGCCTGCAGTATGCCACATCAATAGCCATGTTATTCGAACCATGTCGAGACCTCTCTAGGATGAACAAACAGCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	20.20%	6.73%	3.98%	CAA: 0.04%
All Indica	2759	96.10%	3.50%	0.33%	0.07%	NA
All Japonica	1512	13.60%	54.20%	20.11%	12.04%	CAA: 0.13%
Aus	269	93.30%	5.90%	0.74%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	96.80%	2.80%	0.22%	0.22%	NA
Indica III	913	94.50%	5.10%	0.33%	0.00%	NA
Indica Intermediate	786	94.70%	4.70%	0.51%	0.13%	NA
Temperate Japonica	767	10.20%	61.80%	20.34%	7.69%	NA
Tropical Japonica	504	13.90%	40.90%	23.02%	21.83%	CAA: 0.40%
Japonica Intermediate	241	23.70%	57.70%	13.28%	5.39%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	23.30%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122614316	C -> T	LOC_Os11g38130.1	upstream_gene_variant ; 1794.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> T	LOC_Os11g38140.1	downstream_gene_variant ; 561.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> T	LOC_Os11g38150.1	downstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> T	LOC_Os11g38130-LOC_Os11g38140	intergenic_region ; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> CAA	LOC_Os11g38130.1	upstream_gene_variant ; 1795.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> CAA	LOC_Os11g38140.1	downstream_gene_variant ; 560.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> CAA	LOC_Os11g38150.1	downstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> CAA	LOC_Os11g38130-LOC_Os11g38140	intergenic_region ; MODIFIER	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N
vg1122614316	C -> DEL	N	N	silent_mutation	Average:54.761; most accessible tissue: Callus, score: 98.346	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122614316	NA	2.14E-08	mr1071	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	4.35E-09	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	3.30E-09	mr1140	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.72E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	4.30E-08	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	6.42E-08	1.34E-12	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	2.70E-08	mr1618	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.83E-07	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	5.27E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	9.04E-07	9.04E-07	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.17E-19	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	2.85E-06	4.71E-13	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	7.29E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	9.18E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.32E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.11E-08	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	2.01E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.80E-08	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	1.41E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122614316	NA	4.71E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251