| Variant ID: vg1122614316 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 22614316 |
| Reference Allele: C | Alternative Allele: T,CAA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGCTGTTTGTTCATCCTAGAGAGGTCTCGACATGGTTCGAATAACATGGCTATTGATGTGGCATACTGCAGGCATCATCATAGAACAAATAATCATGTA[C/T,CAA]
ATTTTTTTTCTTGAGAACCCATATGCATGCCTCTTCACATTTAAAATAAAGACAAAATTGGTTTTATAGCATCAAACGTTTGTGATTTTTGTATGTTAGC
GCTAACATACAAAAATCACAAACGTTTGATGCTATAAAACCAATTTTGTCTTTATTTTAAATGTGAAGAGGCATGCATATGGGTTCTCAAGAAAAAAAAT[G/A,TTG]
TACATGATTATTTGTTCTATGATGATGCCTGCAGTATGCCACATCAATAGCCATGTTATTCGAACCATGTCGAGACCTCTCTAGGATGAACAAACAGCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 20.20% | 6.73% | 3.98% | CAA: 0.04% |
| All Indica | 2759 | 96.10% | 3.50% | 0.33% | 0.07% | NA |
| All Japonica | 1512 | 13.60% | 54.20% | 20.11% | 12.04% | CAA: 0.13% |
| Aus | 269 | 93.30% | 5.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.22% | 0.22% | NA |
| Indica III | 913 | 94.50% | 5.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 4.70% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 10.20% | 61.80% | 20.34% | 7.69% | NA |
| Tropical Japonica | 504 | 13.90% | 40.90% | 23.02% | 21.83% | CAA: 0.40% |
| Japonica Intermediate | 241 | 23.70% | 57.70% | 13.28% | 5.39% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 23.30% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122614316 | C -> T | LOC_Os11g38130.1 | upstream_gene_variant ; 1794.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> T | LOC_Os11g38140.1 | downstream_gene_variant ; 561.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> T | LOC_Os11g38150.1 | downstream_gene_variant ; 4503.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> T | LOC_Os11g38130-LOC_Os11g38140 | intergenic_region ; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> CAA | LOC_Os11g38130.1 | upstream_gene_variant ; 1795.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> CAA | LOC_Os11g38140.1 | downstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> CAA | LOC_Os11g38150.1 | downstream_gene_variant ; 4502.0bp to feature; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> CAA | LOC_Os11g38130-LOC_Os11g38140 | intergenic_region ; MODIFIER | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| vg1122614316 | C -> DEL | N | N | silent_mutation | Average:54.761; most accessible tissue: Callus, score: 98.346 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122614316 | NA | 2.14E-08 | mr1071 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 4.35E-09 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 3.30E-09 | mr1140 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 1.72E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 4.30E-08 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | 6.42E-08 | 1.34E-12 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 2.70E-08 | mr1618 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 1.83E-07 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | NA | 5.27E-20 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122614316 | 9.04E-07 | 9.04E-07 | mr1795 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/