\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122554957:

Variant ID: vg1122554957 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22554957
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CAATGCAAACAGAAGGCTTTGTTGTTGGTGGTGATGGTGATGGCAAGGAACACTGTTTGTTACTCCCTCCGTTTTAAGTCATTCTAACATTTCCCATATT[T/C]
AAATTGATGTTAATAAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATATGGAAAATGCTAGAATGACTTACATTGTGAAACGGAG

Reverse complement sequence

CTCCGTTTCACAATGTAAGTCATTCTAGCATTTTCCATATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTTATTAACATCAATTT[A/G]
AATATGGGAAATGTTAGAATGACTTAAAACGGAGGGAGTAACAAACAGTGTTCCTTGCCATCACCATCACCACCAACAACAAAGCCTTCTGTTTGCATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 20.30% 2.77% 11.62% NA
All Indica  2759 87.20% 9.00% 0.29% 3.48% NA
All Japonica  1512 31.70% 43.30% 6.81% 18.25% NA
Aus  269 21.60% 12.30% 6.32% 59.85% NA
Indica I  595 99.00% 0.30% 0.00% 0.67% NA
Indica II  465 69.50% 29.70% 0.22% 0.65% NA
Indica III  913 91.60% 2.20% 0.11% 6.13% NA
Indica Intermediate  786 83.70% 11.30% 0.76% 4.20% NA
Temperate Japonica  767 38.20% 35.60% 3.39% 22.82% NA
Tropical Japonica  504 22.40% 49.80% 12.30% 15.48% NA
Japonica Intermediate  241 30.30% 53.90% 6.22% 9.54% NA
VI/Aromatic  96 86.50% 7.30% 0.00% 6.25% NA
Intermediate  90 67.80% 17.80% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122554957 T -> DEL N N silent_mutation Average:81.968; most accessible tissue: Minghui63 flower, score: 93.748 N N N N
vg1122554957 T -> C LOC_Os11g38020.1 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:81.968; most accessible tissue: Minghui63 flower, score: 93.748 N N N N
vg1122554957 T -> C LOC_Os11g38010.1 downstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:81.968; most accessible tissue: Minghui63 flower, score: 93.748 N N N N
vg1122554957 T -> C LOC_Os11g38010-LOC_Os11g38020 intergenic_region ; MODIFIER silent_mutation Average:81.968; most accessible tissue: Minghui63 flower, score: 93.748 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122554957 T C -0.02 -0.02 -0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122554957 NA 9.55E-07 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 7.00E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 3.92E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.47E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 5.86E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 5.73E-06 mr1835 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 2.73E-06 NA mr1889 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 6.53E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 4.21E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.15E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 8.66E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 9.69E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 4.80E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 6.38E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.15E-06 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.01E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 3.14E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 9.74E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 2.64E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.19E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 1.34E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122554957 NA 3.22E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251