\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122543342:

Variant ID: vg1122543342 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22543342
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.25, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTGCTCATATATGTTTTGGGTGTGTTTAGTTCCTGAAAAAAGTTAAAAGTTTGTGTGTGTAAGAAAGTTTTTGATATGATATAATGTGATGAAAAGTT[A/G]
GGAATAGGGAGAAAACTAAACACGGCCTCAGCCCTCGTATCACCACCCTCGCCTTCCCCCGCATCCGCCGTCGTCCCCACTCGCGCGCGCGACGGTTGTG

Reverse complement sequence

CACAACCGTCGCGCGCGCGAGTGGGGACGACGGCGGATGCGGGGGAAGGCGAGGGTGGTGATACGAGGGCTGAGGCCGTGTTTAGTTTTCTCCCTATTCC[T/C]
AACTTTTCATCACATTATATCATATCAAAAACTTTCTTACACACACAAACTTTTAACTTTTTTCAGGAACTAAACACACCCAAAACATATATGAGCAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 34.00% 0.57% 19.64% NA
All Indica  2759 50.00% 39.70% 0.58% 9.79% NA
All Japonica  1512 47.80% 10.60% 0.53% 41.07% NA
Aus  269 8.90% 84.80% 0.37% 5.95% NA
Indica I  595 85.00% 8.90% 0.67% 5.38% NA
Indica II  465 31.00% 67.50% 0.43% 1.08% NA
Indica III  913 37.10% 43.80% 0.33% 18.73% NA
Indica Intermediate  786 49.60% 41.60% 0.89% 7.89% NA
Temperate Japonica  767 43.50% 6.50% 0.78% 49.15% NA
Tropical Japonica  504 58.50% 13.50% 0.40% 27.58% NA
Japonica Intermediate  241 38.60% 17.80% 0.00% 43.57% NA
VI/Aromatic  96 2.10% 85.40% 0.00% 12.50% NA
Intermediate  90 42.20% 45.60% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122543342 A -> DEL N N silent_mutation Average:91.658; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N
vg1122543342 A -> G LOC_Os11g38000.1 downstream_gene_variant ; 3244.0bp to feature; MODIFIER silent_mutation Average:91.658; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N
vg1122543342 A -> G LOC_Os11g38000-LOC_Os11g38010 intergenic_region ; MODIFIER silent_mutation Average:91.658; most accessible tissue: Zhenshan97 panicle, score: 97.512 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122543342 A G 0.01 -0.01 0.0 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122543342 NA 7.02E-07 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 2.95E-06 NA mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 1.10E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 9.42E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 3.02E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 8.16E-10 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.34E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.41E-10 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 9.12E-11 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.89E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 9.38E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 5.28E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 7.87E-06 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 1.08E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.67E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.17E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 1.11E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 5.00E-09 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122543342 NA 2.92E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251