\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122531121:

Variant ID: vg1122531121 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22531121
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTACAGTAAACTTTTGATAATTATTGATTAATTAGGCTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATGAAATTAGTTTTTTTACTAGTCTAG[G/A]
TTTAATACTCTAAATTAGCGTCCAAACATCCGATGTGACATGGGCTAAAAAGTTTTAGCCCCATCTAAACACCCCCTAATGCATTTATGTAGTAAAGATA

Reverse complement sequence

TATCTTTACTACATAAATGCATTAGGGGGTGTTTAGATGGGGCTAAAACTTTTTAGCCCATGTCACATCGGATGTTTGGACGCTAATTTAGAGTATTAAA[C/T]
CTAGACTAGTAAAAAAACTAATTTCATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAGCCTAATTAATCAATAATTATCAAAAGTTTACTGTAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 12.80% 9.30% 0.47% 77.49% NA
All Indica  2759 10.10% 0.40% 0.40% 89.13% NA
All Japonica  1512 19.40% 27.70% 0.60% 52.31% NA
Aus  269 5.20% 0.00% 0.00% 94.80% NA
Indica I  595 1.20% 0.20% 0.84% 97.82% NA
Indica II  465 32.90% 1.30% 0.22% 65.59% NA
Indica III  913 3.10% 0.00% 0.22% 96.71% NA
Indica Intermediate  786 11.60% 0.40% 0.38% 87.66% NA
Temperate Japonica  767 34.20% 8.60% 0.78% 56.45% NA
Tropical Japonica  504 1.40% 56.90% 0.40% 41.27% NA
Japonica Intermediate  241 10.00% 27.40% 0.41% 62.24% NA
VI/Aromatic  96 1.00% 0.00% 0.00% 98.96% NA
Intermediate  90 17.80% 11.10% 2.22% 68.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122531121 G -> A LOC_Os11g37990.1 upstream_gene_variant ; 1528.0bp to feature; MODIFIER silent_mutation Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1122531121 G -> A LOC_Os11g38000.1 upstream_gene_variant ; 2732.0bp to feature; MODIFIER silent_mutation Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1122531121 G -> A LOC_Os11g37990-LOC_Os11g38000 intergenic_region ; MODIFIER silent_mutation Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1122531121 G -> DEL N N silent_mutation Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122531121 NA 7.00E-09 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 2.68E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 4.06E-07 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 2.14E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.69E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 7.09E-08 mr1603 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 3.98E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.96E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.77E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 9.54E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.12E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.37E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531121 NA 1.94E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251