\
| Variant ID: vg1122531121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22531121 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 68. )
TGCTACAGTAAACTTTTGATAATTATTGATTAATTAGGCTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATGAAATTAGTTTTTTTACTAGTCTAG[G/A]
TTTAATACTCTAAATTAGCGTCCAAACATCCGATGTGACATGGGCTAAAAAGTTTTAGCCCCATCTAAACACCCCCTAATGCATTTATGTAGTAAAGATA
TATCTTTACTACATAAATGCATTAGGGGGTGTTTAGATGGGGCTAAAACTTTTTAGCCCATGTCACATCGGATGTTTGGACGCTAATTTAGAGTATTAAA[C/T]
CTAGACTAGTAAAAAAACTAATTTCATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAGCCTAATTAATCAATAATTATCAAAAGTTTACTGTAGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 12.80% | 9.30% | 0.47% | 77.49% | NA |
| All Indica | 2759 | 10.10% | 0.40% | 0.40% | 89.13% | NA |
| All Japonica | 1512 | 19.40% | 27.70% | 0.60% | 52.31% | NA |
| Aus | 269 | 5.20% | 0.00% | 0.00% | 94.80% | NA |
| Indica I | 595 | 1.20% | 0.20% | 0.84% | 97.82% | NA |
| Indica II | 465 | 32.90% | 1.30% | 0.22% | 65.59% | NA |
| Indica III | 913 | 3.10% | 0.00% | 0.22% | 96.71% | NA |
| Indica Intermediate | 786 | 11.60% | 0.40% | 0.38% | 87.66% | NA |
| Temperate Japonica | 767 | 34.20% | 8.60% | 0.78% | 56.45% | NA |
| Tropical Japonica | 504 | 1.40% | 56.90% | 0.40% | 41.27% | NA |
| Japonica Intermediate | 241 | 10.00% | 27.40% | 0.41% | 62.24% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 0.00% | 98.96% | NA |
| Intermediate | 90 | 17.80% | 11.10% | 2.22% | 68.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122531121 | G -> A | LOC_Os11g37990.1 | upstream_gene_variant ; 1528.0bp to feature; MODIFIER | silent_mutation | Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1122531121 | G -> A | LOC_Os11g38000.1 | upstream_gene_variant ; 2732.0bp to feature; MODIFIER | silent_mutation | Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1122531121 | G -> A | LOC_Os11g37990-LOC_Os11g38000 | intergenic_region ; MODIFIER | silent_mutation | Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1122531121 | G -> DEL | N | N | silent_mutation | Average:33.039; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122531121 | NA | 7.00E-09 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 2.68E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 4.06E-07 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 2.14E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.69E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 7.09E-08 | mr1603 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 3.98E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.96E-06 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.77E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 9.54E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.12E-10 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.37E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122531121 | NA | 1.94E-08 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |