Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122530345:

Variant ID: vg1122530345 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22530345
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

ATTACAGCATAAAACCAGGACTAGCACGTCGTATGGTCACGTATACTCAATAAATCACGATTGCTCTAAAAATATTTAATCTATACTACTAGGATAAAAT[A/G]
GTGGTGGTGGCAGTCTGTCAGCGACTCACCATCACTATTTTTTTATTCTAAAAAATGGGTTAATTGGATACATGCTATTATAAATTTGGCCTGCTGTTCT

Reverse complement sequence

AGAACAGCAGGCCAAATTTATAATAGCATGTATCCAATTAACCCATTTTTTAGAATAAAAAAATAGTGATGGTGAGTCGCTGACAGACTGCCACCACCAC[T/C]
ATTTTATCCTAGTAGTATAGATTAAATATTTTTAGAGCAATCGTGATTTATTGAGTATACGTGACCATACGACGTGCTAGTCCTGGTTTTATGCTGTAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	15.50%	16.69%	6.47%	NA
All Indica	2759	43.00%	22.80%	24.76%	9.42%	NA
All Japonica	1512	92.10%	4.00%	1.92%	1.92%	NA
Aus	269	60.60%	10.40%	23.42%	5.58%	NA
Indica I	595	33.90%	7.70%	50.42%	7.90%	NA
Indica II	465	47.70%	35.90%	11.61%	4.73%	NA
Indica III	913	44.80%	24.40%	16.43%	14.35%	NA
Indica Intermediate	786	45.00%	24.60%	22.77%	7.63%	NA
Temperate Japonica	767	95.30%	2.20%	1.69%	0.78%	NA
Tropical Japonica	504	89.50%	7.50%	1.19%	1.79%	NA
Japonica Intermediate	241	87.60%	2.50%	4.15%	5.81%	NA
VI/Aromatic	96	92.70%	5.20%	2.08%	0.00%	NA
Intermediate	90	73.30%	11.10%	13.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122530345	A -> DEL	N	N	silent_mutation	Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461	N	N	N	N
vg1122530345	A -> G	LOC_Os11g37990.1	upstream_gene_variant ; 752.0bp to feature; MODIFIER	silent_mutation	Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461	N	N	N	N
vg1122530345	A -> G	LOC_Os11g38000.1	upstream_gene_variant ; 3508.0bp to feature; MODIFIER	silent_mutation	Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461	N	N	N	N
vg1122530345	A -> G	LOC_Os11g37990-LOC_Os11g38000	intergenic_region ; MODIFIER	silent_mutation	Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122530345	2.14E-06	NA	mr1526	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251