\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122530345:

Variant ID: vg1122530345 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22530345
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATTACAGCATAAAACCAGGACTAGCACGTCGTATGGTCACGTATACTCAATAAATCACGATTGCTCTAAAAATATTTAATCTATACTACTAGGATAAAAT[A/G]
GTGGTGGTGGCAGTCTGTCAGCGACTCACCATCACTATTTTTTTATTCTAAAAAATGGGTTAATTGGATACATGCTATTATAAATTTGGCCTGCTGTTCT

Reverse complement sequence

AGAACAGCAGGCCAAATTTATAATAGCATGTATCCAATTAACCCATTTTTTAGAATAAAAAAATAGTGATGGTGAGTCGCTGACAGACTGCCACCACCAC[T/C]
ATTTTATCCTAGTAGTATAGATTAAATATTTTTAGAGCAATCGTGATTTATTGAGTATACGTGACCATACGACGTGCTAGTCCTGGTTTTATGCTGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 15.50% 16.69% 6.47% NA
All Indica  2759 43.00% 22.80% 24.76% 9.42% NA
All Japonica  1512 92.10% 4.00% 1.92% 1.92% NA
Aus  269 60.60% 10.40% 23.42% 5.58% NA
Indica I  595 33.90% 7.70% 50.42% 7.90% NA
Indica II  465 47.70% 35.90% 11.61% 4.73% NA
Indica III  913 44.80% 24.40% 16.43% 14.35% NA
Indica Intermediate  786 45.00% 24.60% 22.77% 7.63% NA
Temperate Japonica  767 95.30% 2.20% 1.69% 0.78% NA
Tropical Japonica  504 89.50% 7.50% 1.19% 1.79% NA
Japonica Intermediate  241 87.60% 2.50% 4.15% 5.81% NA
VI/Aromatic  96 92.70% 5.20% 2.08% 0.00% NA
Intermediate  90 73.30% 11.10% 13.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122530345 A -> DEL N N silent_mutation Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461 N N N N
vg1122530345 A -> G LOC_Os11g37990.1 upstream_gene_variant ; 752.0bp to feature; MODIFIER silent_mutation Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461 N N N N
vg1122530345 A -> G LOC_Os11g38000.1 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461 N N N N
vg1122530345 A -> G LOC_Os11g37990-LOC_Os11g38000 intergenic_region ; MODIFIER silent_mutation Average:78.039; most accessible tissue: Minghui63 flower, score: 87.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122530345 2.14E-06 NA mr1526 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251