\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122523293:

Variant ID: vg1122523293 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22523293
Reference Allele: AGGAlternative Allele: A,AG,GGG
Primary Allele: AGGSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGTAAACGGTGAAGGGTTGTGATTGGTTAGGAAGAGAATGTTGGTGAAGTTATTATATTTTAGGACAAATCCTGAGGACTAAAAATTGTTATATTTT[AGG/A,AG,GGG]
ACATTTTAGGACAGAGGGAGTACTAATTACAAGGATCATCAGGGCTTCAGGAAGTTGCTCCTTTTACTCTGCTGGTGCTCCTGATGATCTGTAAAAGTGT

Reverse complement sequence

ACACTTTTACAGATCATCAGGAGCACCAGCAGAGTAAAAGGAGCAACTTCCTGAAGCCCTGATGATCCTTGTAATTAGTACTCCCTCTGTCCTAAAATGT[CCT/T,CT,CCC]
AAAATATAACAATTTTTAGTCCTCAGGATTTGTCCTAAAATATAATAACTTCACCAACATTCTCTTCCTAACCAATCACAACCCTTCACCGTTTACTTTT

Allele Frequencies:

Populations Population SizeFrequency of AGG(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.90% 10.30% 4.08% 67.96% AG: 0.55%; GGG: 0.25%
All Indica  2759 2.10% 0.40% 1.23% 95.61% GGG: 0.36%; AG: 0.29%
All Japonica  1512 47.60% 30.00% 8.07% 13.23% AG: 1.06%; GGG: 0.07%
Aus  269 0.00% 6.30% 2.97% 89.96% AG: 0.37%; GGG: 0.37%
Indica I  595 1.50% 0.20% 0.50% 97.48% GGG: 0.34%
Indica II  465 4.30% 0.00% 2.15% 92.69% AG: 0.43%; GGG: 0.43%
Indica III  913 1.30% 0.10% 1.86% 96.17% GGG: 0.33%; AG: 0.22%
Indica Intermediate  786 2.00% 1.30% 0.51% 95.29% AG: 0.51%; GGG: 0.38%
Temperate Japonica  767 42.10% 34.70% 10.17% 10.95% AG: 2.09%
Tropical Japonica  504 60.30% 25.00% 2.38% 12.30% NA
Japonica Intermediate  241 38.20% 25.70% 13.28% 22.41% GGG: 0.41%
VI/Aromatic  96 2.10% 0.00% 21.88% 76.04% NA
Intermediate  90 21.10% 3.30% 8.89% 65.56% AG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122523293 AGG -> GGG LOC_Os11g37990.1 downstream_gene_variant ; 283.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> GGG LOC_Os11g37980-LOC_Os11g37990 intergenic_region ; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> A LOC_Os11g37990.1 downstream_gene_variant ; 282.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> A LOC_Os11g37980-LOC_Os11g37990 intergenic_region ; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> AG LOC_Os11g37990.1 downstream_gene_variant ; 281.0bp to feature; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> AG LOC_Os11g37980-LOC_Os11g37990 intergenic_region ; MODIFIER silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N
vg1122523293 AGG -> DEL N N silent_mutation Average:66.471; most accessible tissue: Callus, score: 87.002 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122523293 NA 3.09E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.07E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 4.05E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 6.01E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.53E-07 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.03E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.48E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.13E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.05E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.43E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.57E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 7.10E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 6.35E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.35E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.29E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.05E-08 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 7.59E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 4.86E-14 mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 5.83E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.66E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 5.87E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.67E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 9.38E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.42E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.67E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.53E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.03E-06 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.43E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.70E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 9.37E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.64E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 1.27E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 7.62E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.03E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.14E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 6.50E-08 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 3.42E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122523293 NA 2.34E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251