\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122522843:

Variant ID: vg1122522843 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22522843
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCAGTAGTATGTTCGTGGGCCGGGCCGGGCCGGATCCGGCGTGGGTCAGCCAATCGTTGCTCGCCACGTCAGAGAATTACAGTGGTTCAAAGAAAATC[T/A]
ACTCCTCCCGTCCAGCTCAAAGACAAACTATTTTTTTTTAGGTTTGACGAAATTTGTCGAAAAACTAACAACATTTACGATAACAAATTAGTTTTATTGA

Reverse complement sequence

TCAATAAAACTAATTTGTTATCGTAAATGTTGTTAGTTTTTCGACAAATTTCGTCAAACCTAAAAAAAAATAGTTTGTCTTTGAGCTGGACGGGAGGAGT[A/T]
GATTTTCTTTGAACCACTGTAATTCTCTGACGTGGCGAGCAACGATTGGCTGACCCACGCCGGATCCGGCCCGGCCCGGCCCACGAACATACTACTGCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 36.50% 0.87% 4.27% NA
All Indica  2759 39.80% 51.90% 1.30% 6.96% NA
All Japonica  1512 96.60% 3.20% 0.07% 0.13% NA
Aus  269 19.70% 78.10% 0.74% 1.49% NA
Indica I  595 15.10% 84.50% 0.17% 0.17% NA
Indica II  465 41.90% 28.60% 2.58% 26.88% NA
Indica III  913 56.30% 41.90% 0.99% 0.77% NA
Indica Intermediate  786 38.20% 52.50% 1.78% 7.51% NA
Temperate Japonica  767 95.80% 4.00% 0.13% 0.00% NA
Tropical Japonica  504 97.60% 2.20% 0.00% 0.20% NA
Japonica Intermediate  241 97.10% 2.50% 0.00% 0.41% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 62.20% 32.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122522843 T -> A LOC_Os11g37980.1 upstream_gene_variant ; 4732.0bp to feature; MODIFIER silent_mutation Average:81.748; most accessible tissue: Callus, score: 95.331 N N N N
vg1122522843 T -> A LOC_Os11g37990.1 downstream_gene_variant ; 733.0bp to feature; MODIFIER silent_mutation Average:81.748; most accessible tissue: Callus, score: 95.331 N N N N
vg1122522843 T -> A LOC_Os11g37980-LOC_Os11g37990 intergenic_region ; MODIFIER silent_mutation Average:81.748; most accessible tissue: Callus, score: 95.331 N N N N
vg1122522843 T -> DEL N N silent_mutation Average:81.748; most accessible tissue: Callus, score: 95.331 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122522843 T A -0.01 -0.01 -0.01 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122522843 NA 8.59E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.18E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.07E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 6.33E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.25E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 6.20E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.85E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 4.34E-06 4.31E-06 mr1497 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 5.78E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 5.55E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 4.13E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 4.44E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 9.95E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 5.11E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 3.17E-06 3.15E-06 mr1869 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.19E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 6.72E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 2.79E-08 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 2.01E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122522843 NA 1.40E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251