Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122521214:

Variant ID: vg1122521214 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22521214
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

GCGCTTCGCACGACTGCTCCCTGTTCGTCCGTGACAGCTCGCCTTCCTCTCCGCTCGCGTGCTGCGCGCCTTCGTCGACGCCCGCAACCGCGAGTAGTTC[T/C]
TGCCGAACAACCGGTCTTTCCGCCACCTCGGTACGTGCTCAGTATGTTGTGCATATTTGATATGTTCATGTTTTACTGCTTAGTTTACATGTATAGATCT

Reverse complement sequence

AGATCTATACATGTAAACTAAGCAGTAAAACATGAACATATCAAATATGCACAACATACTGAGCACGTACCGAGGTGGCGGAAAGACCGGTTGTTCGGCA[A/G]
GAACTACTCGCGGTTGCGGGCGTCGACGAAGGCGCGCAGCACGCGAGCGGAGAGGAAGGCGAGCTGTCACGGACGAACAGGGAGCAGTCGTGCGAAGCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	21.30%	0.51%	21.73%	NA
All Indica	2759	74.70%	10.10%	0.40%	14.79%	NA
All Japonica	1512	21.40%	45.50%	0.73%	32.41%	NA
Aus	269	82.20%	5.20%	0.74%	11.90%	NA
Indica I	595	93.40%	1.00%	0.00%	5.55%	NA
Indica II	465	64.90%	33.10%	0.22%	1.72%	NA
Indica III	913	65.50%	3.20%	0.77%	30.56%	NA
Indica Intermediate	786	76.80%	11.60%	0.38%	11.20%	NA
Temperate Japonica	767	20.60%	40.20%	1.17%	38.07%	NA
Tropical Japonica	504	15.10%	58.30%	0.00%	26.59%	NA
Japonica Intermediate	241	36.90%	35.70%	0.83%	26.56%	NA
VI/Aromatic	96	14.60%	1.00%	0.00%	84.38%	NA
Intermediate	90	55.60%	26.70%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122521214	T -> DEL	N	N	silent_mutation	Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1122521214	T -> C	LOC_Os11g37980.1	upstream_gene_variant ; 3103.0bp to feature; MODIFIER	silent_mutation	Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1122521214	T -> C	LOC_Os11g37990.1	downstream_gene_variant ; 2362.0bp to feature; MODIFIER	silent_mutation	Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1122521214	T -> C	LOC_Os11g37980-LOC_Os11g37990	intergenic_region ; MODIFIER	silent_mutation	Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122521214	NA	6.50E-07	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	4.06E-09	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	4.93E-10	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	7.91E-07	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.27E-07	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	2.02E-12	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	3.32E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	8.76E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	2.19E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.63E-08	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	2.99E-11	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	3.60E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.70E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.34E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	9.02E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	8.47E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	7.92E-08	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	8.00E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	8.28E-09	mr1355_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	4.16E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	5.42E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	5.49E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	2.82E-08	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	7.56E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	5.32E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	3.08E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	6.94E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	3.35E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.39E-09	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	2.04E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	1.38E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	5.60E-07	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	5.24E-08	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	8.40E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	3.96E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214	NA	6.04E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251