\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122521214:

Variant ID: vg1122521214 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22521214
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCTTCGCACGACTGCTCCCTGTTCGTCCGTGACAGCTCGCCTTCCTCTCCGCTCGCGTGCTGCGCGCCTTCGTCGACGCCCGCAACCGCGAGTAGTTC[T/C]
TGCCGAACAACCGGTCTTTCCGCCACCTCGGTACGTGCTCAGTATGTTGTGCATATTTGATATGTTCATGTTTTACTGCTTAGTTTACATGTATAGATCT

Reverse complement sequence

AGATCTATACATGTAAACTAAGCAGTAAAACATGAACATATCAAATATGCACAACATACTGAGCACGTACCGAGGTGGCGGAAAGACCGGTTGTTCGGCA[A/G]
GAACTACTCGCGGTTGCGGGCGTCGACGAAGGCGCGCAGCACGCGAGCGGAGAGGAAGGCGAGCTGTCACGGACGAACAGGGAGCAGTCGTGCGAAGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 21.30% 0.51% 21.73% NA
All Indica  2759 74.70% 10.10% 0.40% 14.79% NA
All Japonica  1512 21.40% 45.50% 0.73% 32.41% NA
Aus  269 82.20% 5.20% 0.74% 11.90% NA
Indica I  595 93.40% 1.00% 0.00% 5.55% NA
Indica II  465 64.90% 33.10% 0.22% 1.72% NA
Indica III  913 65.50% 3.20% 0.77% 30.56% NA
Indica Intermediate  786 76.80% 11.60% 0.38% 11.20% NA
Temperate Japonica  767 20.60% 40.20% 1.17% 38.07% NA
Tropical Japonica  504 15.10% 58.30% 0.00% 26.59% NA
Japonica Intermediate  241 36.90% 35.70% 0.83% 26.56% NA
VI/Aromatic  96 14.60% 1.00% 0.00% 84.38% NA
Intermediate  90 55.60% 26.70% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122521214 T -> DEL N N silent_mutation Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1122521214 T -> C LOC_Os11g37980.1 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1122521214 T -> C LOC_Os11g37990.1 downstream_gene_variant ; 2362.0bp to feature; MODIFIER silent_mutation Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1122521214 T -> C LOC_Os11g37980-LOC_Os11g37990 intergenic_region ; MODIFIER silent_mutation Average:54.025; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122521214 NA 6.50E-07 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 4.06E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 4.93E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 7.91E-07 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.27E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 2.02E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 3.32E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 8.76E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 2.19E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.63E-08 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 2.99E-11 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 3.60E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.70E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.34E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 9.02E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 8.47E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 7.92E-08 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 8.00E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 8.28E-09 mr1355_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 4.16E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 5.42E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 5.49E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 2.82E-08 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 7.56E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 5.32E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 3.08E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 6.94E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 3.35E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.39E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 2.04E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 1.38E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 5.60E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 5.24E-08 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 8.40E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 3.96E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122521214 NA 6.04E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251