\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122510926:

Variant ID: vg1122510926 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22510926
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGATAAGGTTTTGGAACGGCTGCTACACGTACGAACCAAAAGGATGACCAAGAAGGAGAATTTGAAGATTTTTTTATAGTATTAATTATGATTGTTGA[T/A]
CGAATTCGTCAATGGCAAAATCGGCCTGGCTCTGGCTGGCTGGCTGCTAATTCATTCCAGAAGGTAGCCAGGAATTTGGAGGTAGGACTAGCATTTACAT

Reverse complement sequence

ATGTAAATGCTAGTCCTACCTCCAAATTCCTGGCTACCTTCTGGAATGAATTAGCAGCCAGCCAGCCAGAGCCAGGCCGATTTTGCCATTGACGAATTCG[A/T]
TCAACAATCATAATTAATACTATAAAAAAATCTTCAAATTCTCCTTCTTGGTCATCCTTTTGGTTCGTACGTGTAGCAGCCGTTCCAAAACCTTATCTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 42.80% 0.19% 0.00% NA
All Indica  2759 37.90% 61.80% 0.25% 0.00% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 16.00% 83.60% 0.37% 0.00% NA
Indica I  595 14.60% 84.90% 0.50% 0.00% NA
Indica II  465 63.70% 36.30% 0.00% 0.00% NA
Indica III  913 39.50% 60.40% 0.11% 0.00% NA
Indica Intermediate  786 38.50% 61.10% 0.38% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122510926 T -> A LOC_Os11g37970.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:63.432; most accessible tissue: Callus, score: 86.734 N N N N
vg1122510926 T -> A LOC_Os11g37960.1 downstream_gene_variant ; 3507.0bp to feature; MODIFIER silent_mutation Average:63.432; most accessible tissue: Callus, score: 86.734 N N N N
vg1122510926 T -> A LOC_Os11g37980.1 downstream_gene_variant ; 3261.0bp to feature; MODIFIER silent_mutation Average:63.432; most accessible tissue: Callus, score: 86.734 N N N N
vg1122510926 T -> A LOC_Os11g37960-LOC_Os11g37970 intergenic_region ; MODIFIER silent_mutation Average:63.432; most accessible tissue: Callus, score: 86.734 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122510926 NA 8.33E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.08E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 4.12E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 9.52E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.57E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.43E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 8.34E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 3.18E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.06E-08 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 7.85E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.92E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.84E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 4.25E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 2.42E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 3.55E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.17E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 8.58E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 9.28E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.33E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.43E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 5.23E-13 mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 3.44E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 7.59E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 3.56E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 2.38E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 1.67E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926 NA 2.09E-09 mr1942_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251