Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122510926:

Variant ID: vg1122510926 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22510926
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GCAGATAAGGTTTTGGAACGGCTGCTACACGTACGAACCAAAAGGATGACCAAGAAGGAGAATTTGAAGATTTTTTTATAGTATTAATTATGATTGTTGA[T/A]
CGAATTCGTCAATGGCAAAATCGGCCTGGCTCTGGCTGGCTGGCTGCTAATTCATTCCAGAAGGTAGCCAGGAATTTGGAGGTAGGACTAGCATTTACAT

Reverse complement sequence

ATGTAAATGCTAGTCCTACCTCCAAATTCCTGGCTACCTTCTGGAATGAATTAGCAGCCAGCCAGCCAGAGCCAGGCCGATTTTGCCATTGACGAATTCG[A/T]
TCAACAATCATAATTAATACTATAAAAAAATCTTCAAATTCTCCTTCTTGGTCATCCTTTTGGTTCGTACGTGTAGCAGCCGTTCCAAAACCTTATCTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	42.80%	0.19%	0.00%	NA
All Indica	2759	37.90%	61.80%	0.25%	0.00%	NA
All Japonica	1512	96.70%	3.30%	0.00%	0.00%	NA
Aus	269	16.00%	83.60%	0.37%	0.00%	NA
Indica I	595	14.60%	84.90%	0.50%	0.00%	NA
Indica II	465	63.70%	36.30%	0.00%	0.00%	NA
Indica III	913	39.50%	60.40%	0.11%	0.00%	NA
Indica Intermediate	786	38.50%	61.10%	0.38%	0.00%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122510926	T -> A	LOC_Os11g37970.1	upstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:63.432; most accessible tissue: Callus, score: 86.734	N	N	N	N
vg1122510926	T -> A	LOC_Os11g37960.1	downstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:63.432; most accessible tissue: Callus, score: 86.734	N	N	N	N
vg1122510926	T -> A	LOC_Os11g37980.1	downstream_gene_variant ; 3261.0bp to feature; MODIFIER	silent_mutation	Average:63.432; most accessible tissue: Callus, score: 86.734	N	N	N	N
vg1122510926	T -> A	LOC_Os11g37960-LOC_Os11g37970	intergenic_region ; MODIFIER	silent_mutation	Average:63.432; most accessible tissue: Callus, score: 86.734	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122510926	NA	8.33E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.08E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	4.12E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	9.52E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.57E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.43E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	8.34E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	3.18E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.06E-08	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	7.85E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.92E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.84E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	4.25E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	2.42E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	3.55E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.17E-10	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	8.58E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	9.28E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.33E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.43E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	5.23E-13	mr1986	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	3.44E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	7.59E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	3.56E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	2.38E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	1.67E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122510926	NA	2.09E-09	mr1942_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251