\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122507717:

Variant ID: vg1122507717 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22507717
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAAGTTTTTGCACAAAATATGTTGTTTTGTAGTTTGAAAAGCGTGTTAACGAAAACGGAGATAAAATATTTATCTTTATGAGAAAAGAATGGGCCTC[A/G]
GTGTTAATTTCGTAATTTTGTGGCTCCGTTCCTTTTTTGGGGCGATTGCAAATTTACCACTACTTTAAATCGTTATTGCAAAACTGCCATTAGAAAATTG

Reverse complement sequence

CAATTTTCTAATGGCAGTTTTGCAATAACGATTTAAAGTAGTGGTAAATTTGCAATCGCCCCAAAAAAGGAACGGAGCCACAAAATTACGAAATTAACAC[T/C]
GAGGCCCATTCTTTTCTCATAAAGATAAATATTTTATCTCCGTTTTCGTTAACACGCTTTTCAAACTACAAAACAACATATTTTGTGCAAAAACTTTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 13.10% 0.04% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 60.00% 40.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 50.60% 49.40% 0.00% 0.00% NA
Tropical Japonica  504 75.60% 24.40% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122507717 A -> G LOC_Os11g37970.1 upstream_gene_variant ; 3789.0bp to feature; MODIFIER silent_mutation Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507717 A -> G LOC_Os11g37950.1 downstream_gene_variant ; 4608.0bp to feature; MODIFIER silent_mutation Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507717 A -> G LOC_Os11g37960.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507717 A -> G LOC_Os11g37960-LOC_Os11g37970 intergenic_region ; MODIFIER silent_mutation Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122507717 5.08E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 8.63E-08 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 1.90E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 1.61E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 7.49E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 3.05E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 1.49E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507717 6.54E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251