\
| Variant ID: vg1122507717 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22507717 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGAAAGTTTTTGCACAAAATATGTTGTTTTGTAGTTTGAAAAGCGTGTTAACGAAAACGGAGATAAAATATTTATCTTTATGAGAAAAGAATGGGCCTC[A/G]
GTGTTAATTTCGTAATTTTGTGGCTCCGTTCCTTTTTTGGGGCGATTGCAAATTTACCACTACTTTAAATCGTTATTGCAAAACTGCCATTAGAAAATTG
CAATTTTCTAATGGCAGTTTTGCAATAACGATTTAAAGTAGTGGTAAATTTGCAATCGCCCCAAAAAAGGAACGGAGCCACAAAATTACGAAATTAACAC[T/C]
GAGGCCCATTCTTTTCTCATAAAGATAAATATTTTATCTCCGTTTTCGTTAACACGCTTTTCAAACTACAAAACAACATATTTTGTGCAAAAACTTTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122507717 | A -> G | LOC_Os11g37970.1 | upstream_gene_variant ; 3789.0bp to feature; MODIFIER | silent_mutation | Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| vg1122507717 | A -> G | LOC_Os11g37950.1 | downstream_gene_variant ; 4608.0bp to feature; MODIFIER | silent_mutation | Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| vg1122507717 | A -> G | LOC_Os11g37960.1 | downstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| vg1122507717 | A -> G | LOC_Os11g37960-LOC_Os11g37970 | intergenic_region ; MODIFIER | silent_mutation | Average:44.553; most accessible tissue: Zhenshan97 root, score: 74.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122507717 | 5.08E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 8.63E-08 | NA | mr1140 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 1.90E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 1.61E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 7.49E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 3.05E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 1.49E-07 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122507717 | 6.54E-08 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |