\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122507712:

Variant ID: vg1122507712 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22507712
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATATAGAAAGTTTTTGCACAAAATATGTTGTTTTGTAGTTTGAAAAGCGTGTTAACGAAAACGGAGATAAAATATTTATCTTTATGAGAAAAGAATGG[G/A]
CCTCAGTGTTAATTTCGTAATTTTGTGGCTCCGTTCCTTTTTTGGGGCGATTGCAAATTTACCACTACTTTAAATCGTTATTGCAAAACTGCCATTAGAA

Reverse complement sequence

TTCTAATGGCAGTTTTGCAATAACGATTTAAAGTAGTGGTAAATTTGCAATCGCCCCAAAAAAGGAACGGAGCCACAAAATTACGAAATTAACACTGAGG[C/T]
CCATTCTTTTCTCATAAAGATAAATATTTTATCTCCGTTTTCGTTAACACGCTTTTCAAACTACAAAACAACATATTTTGTGCAAAAACTTTCTATATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 9.10% 0.11% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 71.80% 28.00% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 66.20% 33.40% 0.39% 0.00% NA
Tropical Japonica  504 78.00% 22.00% 0.00% 0.00% NA
Japonica Intermediate  241 76.30% 23.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122507712 G -> A LOC_Os11g37970.1 upstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:44.922; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507712 G -> A LOC_Os11g37950.1 downstream_gene_variant ; 4603.0bp to feature; MODIFIER silent_mutation Average:44.922; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507712 G -> A LOC_Os11g37960.1 downstream_gene_variant ; 293.0bp to feature; MODIFIER silent_mutation Average:44.922; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg1122507712 G -> A LOC_Os11g37960-LOC_Os11g37970 intergenic_region ; MODIFIER silent_mutation Average:44.922; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122507712 5.22E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 NA 2.21E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 NA 7.25E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 6.51E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 7.16E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 4.21E-06 NA mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 3.65E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 4.51E-07 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 2.70E-09 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 2.30E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 9.58E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 9.84E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122507712 2.15E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251