\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122506020:

Variant ID: vg1122506020 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22506020
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGTCAGCCATGACTTAGACGCGTTTACCTCCTTCTGGCTCTATTTAAGCTTGTGGAATCGAAGCAACCTCCATTTCACTAGCATCTAGCAAGTGCACA[A/G]
CACATCTATAAATCGTAGTAACCACCTTAGGTGAGATGATGGTCATGGCGATGATGAGAAGGGTGGTGATGGTGGTGGCGGTGCTGTGTGCGGTAGCAAC

Reverse complement sequence

GTTGCTACCGCACACAGCACCGCCACCACCATCACCACCCTTCTCATCATCGCCATGACCATCATCTCACCTAAGGTGGTTACTACGATTTATAGATGTG[T/C]
TGTGCACTTGCTAGATGCTAGTGAAATGGAGGTTGCTTCGATTCCACAAGCTTAAATAGAGCCAGAAGGAGGTAAACGCGTCTAAGTCATGGCTGACTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 44.10% 0.23% 0.04% NA
All Indica  2759 36.80% 62.80% 0.36% 0.07% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 14.50% 85.50% 0.00% 0.00% NA
Indica I  595 20.00% 79.80% 0.17% 0.00% NA
Indica II  465 49.20% 50.10% 0.22% 0.43% NA
Indica III  913 40.10% 59.80% 0.11% 0.00% NA
Indica Intermediate  786 38.20% 60.90% 0.89% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122506020 A -> DEL N N silent_mutation Average:92.552; most accessible tissue: Zhenshan97 root, score: 98.439 N N N N
vg1122506020 A -> G LOC_Os11g37960.1 5_prime_UTR_variant ; 36.0bp to feature; MODIFIER silent_mutation Average:92.552; most accessible tissue: Zhenshan97 root, score: 98.439 N N N N
vg1122506020 A -> G LOC_Os11g37944.1 upstream_gene_variant ; 4826.0bp to feature; MODIFIER silent_mutation Average:92.552; most accessible tissue: Zhenshan97 root, score: 98.439 N N N N
vg1122506020 A -> G LOC_Os11g37950.1 downstream_gene_variant ; 2911.0bp to feature; MODIFIER silent_mutation Average:92.552; most accessible tissue: Zhenshan97 root, score: 98.439 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122506020 A G 0.05 0.04 0.07 -0.01 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122506020 NA 5.19E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 1.56E-06 8.16E-11 mr1170 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 6.47E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 5.33E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 6.76E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 9.84E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 9.79E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 4.62E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 3.16E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 2.78E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506020 NA 1.23E-11 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251