\
| Variant ID: vg1122505213 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22505213 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATATATAAAAGTTTTTGTTTATAAATTATTTTTTAAGTCGTTAATAAATACTCCCTCCTTCCCTAAATGTTTGACACCTTTGACTTTTTTAAACATGTT[T/A]
GACCGTTCGTTTTATTCAAAAACTTTTGTGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAA
TTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCACAAAAGTTTTTGAATAAAACGAACGGTC[A/T]
AACATGTTTAAAAAAGTCAAAGGTGTCAAACATTTAGGGAAGGAGGGAGTATTTATTAACGACTTAAAAAATAATTTATAAACAAAAACTTTTATATATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 13.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.80% | 40.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122505213 | T -> A | LOC_Os11g37944.1 | upstream_gene_variant ; 4019.0bp to feature; MODIFIER | silent_mutation | Average:46.627; most accessible tissue: Callus, score: 88.51 | N | N | N | N |
| vg1122505213 | T -> A | LOC_Os11g37960.1 | upstream_gene_variant ; 780.0bp to feature; MODIFIER | silent_mutation | Average:46.627; most accessible tissue: Callus, score: 88.51 | N | N | N | N |
| vg1122505213 | T -> A | LOC_Os11g37940.1 | downstream_gene_variant ; 4722.0bp to feature; MODIFIER | silent_mutation | Average:46.627; most accessible tissue: Callus, score: 88.51 | N | N | N | N |
| vg1122505213 | T -> A | LOC_Os11g37950.1 | downstream_gene_variant ; 2104.0bp to feature; MODIFIER | silent_mutation | Average:46.627; most accessible tissue: Callus, score: 88.51 | N | N | N | N |
| vg1122505213 | T -> A | LOC_Os11g37950-LOC_Os11g37960 | intergenic_region ; MODIFIER | silent_mutation | Average:46.627; most accessible tissue: Callus, score: 88.51 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122505213 | 8.04E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 1.06E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 5.28E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | NA | 1.71E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | NA | 1.60E-07 | mr1761 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 6.82E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 2.01E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 2.31E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 8.87E-09 | NA | mr1841_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 5.33E-08 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122505213 | 4.21E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |