\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122505213:

Variant ID: vg1122505213 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22505213
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATATAAAAGTTTTTGTTTATAAATTATTTTTTAAGTCGTTAATAAATACTCCCTCCTTCCCTAAATGTTTGACACCTTTGACTTTTTTAAACATGTT[T/A]
GACCGTTCGTTTTATTCAAAAACTTTTGTGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAA

Reverse complement sequence

TTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCACAAAAGTTTTTGAATAAAACGAACGGTC[A/T]
AACATGTTTAAAAAAGTCAAAGGTGTCAAACATTTAGGGAAGGAGGGAGTATTTATTAACGACTTAAAAAATAATTTATAAACAAAAACTTTTATATATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 13.10% 0.06% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 59.80% 40.10% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 50.20% 49.80% 0.00% 0.00% NA
Tropical Japonica  504 75.60% 24.40% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122505213 T -> A LOC_Os11g37944.1 upstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:46.627; most accessible tissue: Callus, score: 88.51 N N N N
vg1122505213 T -> A LOC_Os11g37960.1 upstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:46.627; most accessible tissue: Callus, score: 88.51 N N N N
vg1122505213 T -> A LOC_Os11g37940.1 downstream_gene_variant ; 4722.0bp to feature; MODIFIER silent_mutation Average:46.627; most accessible tissue: Callus, score: 88.51 N N N N
vg1122505213 T -> A LOC_Os11g37950.1 downstream_gene_variant ; 2104.0bp to feature; MODIFIER silent_mutation Average:46.627; most accessible tissue: Callus, score: 88.51 N N N N
vg1122505213 T -> A LOC_Os11g37950-LOC_Os11g37960 intergenic_region ; MODIFIER silent_mutation Average:46.627; most accessible tissue: Callus, score: 88.51 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122505213 8.04E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 1.06E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 5.28E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 NA 1.71E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 NA 1.60E-07 mr1761 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 6.82E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 2.01E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 2.31E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 8.87E-09 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 5.33E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213 4.21E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251