\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122501574:

Variant ID: vg1122501574 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22501574
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCACCCAGAGAGATTATTATAACTTGTAGCGGTATATTAATGATAAAAAATAATTTATAAGTGTACTTTTATATAAGTATTGTTAGTGCCTTAAAAG[C/T]
TGATACCAATAAATAAACTACATTGATTTTTTTTAAAATCAATTTAAAATTAAAATTTAGGCAACAGTTTTTTTTATAGGATGGAACAAATTAAGCTTAT

Reverse complement sequence

ATAAGCTTAATTTGTTCCATCCTATAAAAAAAACTGTTGCCTAAATTTTAATTTTAAATTGATTTTAAAAAAAATCAATGTAGTTTATTTATTGGTATCA[G/A]
CTTTTAAGGCACTAACAATACTTATATAAAAGTACACTTATAAATTATTTTTTATCATTAATATACCGCTACAAGTTATAATAATCTCTCTGGGTGAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.00% 0.06% 0.00% NA
All Indica  2759 99.20% 0.80% 0.04% 0.00% NA
All Japonica  1512 74.00% 25.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 68.40% 31.60% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 16.70% 0.40% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122501574 C -> T LOC_Os11g37944.1 upstream_gene_variant ; 380.0bp to feature; MODIFIER silent_mutation Average:53.909; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1122501574 C -> T LOC_Os11g37950.1 upstream_gene_variant ; 433.0bp to feature; MODIFIER silent_mutation Average:53.909; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1122501574 C -> T LOC_Os11g37960.1 upstream_gene_variant ; 4419.0bp to feature; MODIFIER silent_mutation Average:53.909; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1122501574 C -> T LOC_Os11g37940.1 downstream_gene_variant ; 1083.0bp to feature; MODIFIER silent_mutation Average:53.909; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N
vg1122501574 C -> T LOC_Os11g37944-LOC_Os11g37950 intergenic_region ; MODIFIER silent_mutation Average:53.909; most accessible tissue: Zhenshan97 root, score: 86.252 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122501574 C T -0.02 -0.03 -0.05 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122501574 5.54E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 5.38E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 3.67E-06 NA mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 4.26E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 NA 3.56E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 NA 2.79E-07 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 6.97E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 2.05E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 3.45E-06 7.21E-06 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 NA 2.81E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122501574 4.72E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251