Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122497642:

Variant ID: vg1122497642 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22497642
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GTTAGATGGGGAAAGAGGGCACATCAGTCCCCTTACATCTATCAACAGGGGTAGAAAGGTGAATCGAGATTTTGCAAAATCAATATTTCCTTTTTTTTCC[T/C]
GATTTCTTCCCCAACAATTCCAAGACCACTCACTTTTGTTAAAAACAAGGTAAAGGGTTCACTAGTTTAAAAAAAACAGGGGCACAAAACGAAAACCCTA

Reverse complement sequence

TAGGGTTTTCGTTTTGTGCCCCTGTTTTTTTTAAACTAGTGAACCCTTTACCTTGTTTTTAACAAAAGTGAGTGGTCTTGGAATTGTTGGGGAAGAAATC[A/G]
GGAAAAAAAAGGAAATATTGATTTTGCAAAATCTCGATTCACCTTTCTACCCCTGTTGATAGATGTAAGGGGACTGATGTGCCCTCTTTCCCCATCTAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.00%	46.40%	0.68%	5.95%	NA
All Indica	2759	38.70%	51.10%	0.94%	9.24%	NA
All Japonica	1512	50.10%	49.40%	0.13%	0.40%	NA
Aus	269	94.10%	0.40%	0.00%	5.58%	NA
Indica I	595	20.80%	73.80%	1.01%	4.37%	NA
Indica II	465	48.80%	49.70%	0.65%	0.86%	NA
Indica III	913	43.00%	37.10%	1.20%	18.62%	NA
Indica Intermediate	786	41.20%	51.00%	0.76%	7.00%	NA
Temperate Japonica	767	52.90%	46.70%	0.00%	0.39%	NA
Tropical Japonica	504	40.70%	59.10%	0.20%	0.00%	NA
Japonica Intermediate	241	60.60%	37.80%	0.41%	1.24%	NA
VI/Aromatic	96	95.80%	1.00%	2.08%	1.04%	NA
Intermediate	90	55.60%	37.80%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122497642	T -> DEL	N	N	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37930.1	upstream_gene_variant ; 2094.0bp to feature; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37940.1	upstream_gene_variant ; 856.0bp to feature; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37950.1	upstream_gene_variant ; 4365.0bp to feature; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37920.1	downstream_gene_variant ; 4559.0bp to feature; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37944.1	downstream_gene_variant ; 2890.0bp to feature; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N
vg1122497642	T -> C	LOC_Os11g37930-LOC_Os11g37940	intergenic_region ; MODIFIER	silent_mutation	Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122497642	1.52E-06	NA	mr1177	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122497642	NA	4.23E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251