\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122497642:

Variant ID: vg1122497642 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22497642
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAGATGGGGAAAGAGGGCACATCAGTCCCCTTACATCTATCAACAGGGGTAGAAAGGTGAATCGAGATTTTGCAAAATCAATATTTCCTTTTTTTTCC[T/C]
GATTTCTTCCCCAACAATTCCAAGACCACTCACTTTTGTTAAAAACAAGGTAAAGGGTTCACTAGTTTAAAAAAAACAGGGGCACAAAACGAAAACCCTA

Reverse complement sequence

TAGGGTTTTCGTTTTGTGCCCCTGTTTTTTTTAAACTAGTGAACCCTTTACCTTGTTTTTAACAAAAGTGAGTGGTCTTGGAATTGTTGGGGAAGAAATC[A/G]
GGAAAAAAAAGGAAATATTGATTTTGCAAAATCTCGATTCACCTTTCTACCCCTGTTGATAGATGTAAGGGGACTGATGTGCCCTCTTTCCCCATCTAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 46.40% 0.68% 5.95% NA
All Indica  2759 38.70% 51.10% 0.94% 9.24% NA
All Japonica  1512 50.10% 49.40% 0.13% 0.40% NA
Aus  269 94.10% 0.40% 0.00% 5.58% NA
Indica I  595 20.80% 73.80% 1.01% 4.37% NA
Indica II  465 48.80% 49.70% 0.65% 0.86% NA
Indica III  913 43.00% 37.10% 1.20% 18.62% NA
Indica Intermediate  786 41.20% 51.00% 0.76% 7.00% NA
Temperate Japonica  767 52.90% 46.70% 0.00% 0.39% NA
Tropical Japonica  504 40.70% 59.10% 0.20% 0.00% NA
Japonica Intermediate  241 60.60% 37.80% 0.41% 1.24% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 55.60% 37.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122497642 T -> DEL N N silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37930.1 upstream_gene_variant ; 2094.0bp to feature; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37940.1 upstream_gene_variant ; 856.0bp to feature; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37950.1 upstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37920.1 downstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37944.1 downstream_gene_variant ; 2890.0bp to feature; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1122497642 T -> C LOC_Os11g37930-LOC_Os11g37940 intergenic_region ; MODIFIER silent_mutation Average:63.082; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122497642 1.52E-06 NA mr1177 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122497642 NA 4.23E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251