\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122487739:

Variant ID: vg1122487739 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22487739
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTCAAGGGCTTGATTGTCTAGATATTGTGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCT[C/T]
TAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGATGAATTATCTAGACGTTGCATCGGCTTATAAGGATTGTATACATATTGGAT

Reverse complement sequence

ATCCAATATGTATACAATCCTTATAAGCCGATGCAACGTCTAGATAATTCATCGGCTGAAACCCCGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTA[G/A]
AGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACACAATATCTAGACAATCAAGCCCTTGACTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.30% 0.13% 0.00% NA
All Indica  2759 92.60% 7.30% 0.11% 0.00% NA
All Japonica  1512 56.20% 43.70% 0.07% 0.00% NA
Aus  269 87.70% 11.90% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 82.70% 17.20% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 4.20% 0.00% 0.00% NA
Temperate Japonica  767 51.50% 48.50% 0.00% 0.00% NA
Tropical Japonica  504 69.60% 30.40% 0.00% 0.00% NA
Japonica Intermediate  241 43.20% 56.40% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122487739 C -> T LOC_Os11g37910.1 upstream_gene_variant ; 1424.0bp to feature; MODIFIER silent_mutation Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg1122487739 C -> T LOC_Os11g37920.1 upstream_gene_variant ; 3679.0bp to feature; MODIFIER silent_mutation Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg1122487739 C -> T LOC_Os11g37900-LOC_Os11g37910 intergenic_region ; MODIFIER silent_mutation Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122487739 3.32E-09 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 4.98E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 NA 1.06E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 5.27E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 2.05E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 1.18E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 1.16E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739 7.65E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251