Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122487739:

Variant ID: vg1122487739 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22487739
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGTCAAGGGCTTGATTGTCTAGATATTGTGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCT[C/T]
TAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGATGAATTATCTAGACGTTGCATCGGCTTATAAGGATTGTATACATATTGGAT

Reverse complement sequence

ATCCAATATGTATACAATCCTTATAAGCCGATGCAACGTCTAGATAATTCATCGGCTGAAACCCCGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTA[G/A]
AGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACACAATATCTAGACAATCAAGCCCTTGACTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	19.30%	0.13%	0.00%	NA
All Indica	2759	92.60%	7.30%	0.11%	0.00%	NA
All Japonica	1512	56.20%	43.70%	0.07%	0.00%	NA
Aus	269	87.70%	11.90%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.20%	0.43%	0.00%	NA
Indica III	913	82.70%	17.20%	0.11%	0.00%	NA
Indica Intermediate	786	95.80%	4.20%	0.00%	0.00%	NA
Temperate Japonica	767	51.50%	48.50%	0.00%	0.00%	NA
Tropical Japonica	504	69.60%	30.40%	0.00%	0.00%	NA
Japonica Intermediate	241	43.20%	56.40%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122487739	C -> T	LOC_Os11g37910.1	upstream_gene_variant ; 1424.0bp to feature; MODIFIER	silent_mutation	Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1122487739	C -> T	LOC_Os11g37920.1	upstream_gene_variant ; 3679.0bp to feature; MODIFIER	silent_mutation	Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1122487739	C -> T	LOC_Os11g37900-LOC_Os11g37910	intergenic_region ; MODIFIER	silent_mutation	Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122487739	3.32E-09	NA	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	4.98E-07	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	NA	1.06E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	5.27E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	2.05E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	1.18E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	1.16E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487739	7.65E-07	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251