\
| Variant ID: vg1122487739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22487739 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 263. )
TCAGTCAAGGGCTTGATTGTCTAGATATTGTGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCT[C/T]
TAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGATGAATTATCTAGACGTTGCATCGGCTTATAAGGATTGTATACATATTGGAT
ATCCAATATGTATACAATCCTTATAAGCCGATGCAACGTCTAGATAATTCATCGGCTGAAACCCCGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTA[G/A]
AGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACACAATATCTAGACAATCAAGCCCTTGACTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 19.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 56.20% | 43.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 87.70% | 11.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 82.70% | 17.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.60% | 30.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122487739 | C -> T | LOC_Os11g37910.1 | upstream_gene_variant ; 1424.0bp to feature; MODIFIER | silent_mutation | Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1122487739 | C -> T | LOC_Os11g37920.1 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1122487739 | C -> T | LOC_Os11g37900-LOC_Os11g37910 | intergenic_region ; MODIFIER | silent_mutation | Average:38.701; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122487739 | 3.32E-09 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 4.98E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | NA | 1.06E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 5.27E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 2.05E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 1.18E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 1.16E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122487739 | 7.65E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |