Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122487710:

Variant ID: vg1122487710 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22487710
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGCTTAGACGTCTACCACCCTGAAAATCAGTCAAGGGCTTGATTGTCTAGATATTGTGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGAT[C/A]
TACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGATGAATTATCTAGACGTTGCATC

Reverse complement sequence

GATGCAACGTCTAGATAATTCATCGGCTGAAACCCCGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTA[G/T]
ATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACACAATATCTAGACAATCAAGCCCTTGACTGATTTTCAGGGTGGTAGACGTCTAAGCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	12.40%	0.40%	0.00%	NA
All Indica	2759	91.50%	7.90%	0.62%	0.00%	NA
All Japonica	1512	89.60%	10.40%	0.07%	0.00%	NA
Aus	269	31.60%	68.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	81.50%	18.50%	0.00%	0.00%	NA
Indica III	913	92.60%	6.20%	1.20%	0.00%	NA
Indica Intermediate	786	90.50%	8.90%	0.64%	0.00%	NA
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.50%	17.30%	0.20%	0.00%	NA
Japonica Intermediate	241	80.90%	19.10%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122487710	C -> A	LOC_Os11g37910.1	upstream_gene_variant ; 1453.0bp to feature; MODIFIER	silent_mutation	Average:37.967; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1122487710	C -> A	LOC_Os11g37920.1	upstream_gene_variant ; 3708.0bp to feature; MODIFIER	silent_mutation	Average:37.967; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1122487710	C -> A	LOC_Os11g37900-LOC_Os11g37910	intergenic_region ; MODIFIER	silent_mutation	Average:37.967; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122487710	NA	1.34E-07	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	2.92E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	5.73E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	2.75E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	1.07E-06	NA	mr1889	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	1.38E-06	2.94E-10	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	1.59E-10	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	9.72E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	9.02E-11	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	3.00E-08	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	6.13E-07	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	1.25E-06	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	7.55E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	1.31E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	3.95E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	2.51E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	1.17E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487710	NA	6.72E-06	mr1893_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251