Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122487318:

Variant ID: vg1122487318 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22487318
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.45, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AATATGTACACCCAGGGTCTATGTAATCCATCAATCACGATCAATACAACTACTCTCGGCGCATCGCCACCCTCTTCCCTGAGGTTTTTACTTATCTTCC[G/A]
GTGGAATTTGGGCACCTGACGCGGGGCTGCATCGGTTTAGTTCGATCTCCAGCGAAGGGGTAAGTCCTACGTTCCGTCAGGCCCTAGTGAATTTGTCATC

Reverse complement sequence

GATGACAAATTCACTAGGGCCTGACGGAACGTAGGACTTACCCCTTCGCTGGAGATCGAACTAAACCGATGCAGCCCCGCGTCAGGTGCCCAAATTCCAC[C/T]
GGAAGATAAGTAAAAACCTCAGGGAAGAGGGTGGCGATGCGCCGAGAGTAGTTGTATTGATCGTGATTGATGGATTACATAGACCCTGGGTGTACATATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.70%	0.15%	0.00%	NA
All Indica	2759	89.20%	10.70%	0.11%	0.00%	NA
All Japonica	1512	50.90%	48.90%	0.20%	0.00%	NA
Aus	269	31.20%	68.80%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	79.10%	20.60%	0.22%	0.00%	NA
Indica III	913	89.50%	10.50%	0.00%	0.00%	NA
Indica Intermediate	786	88.40%	11.30%	0.25%	0.00%	NA
Temperate Japonica	767	55.10%	44.90%	0.00%	0.00%	NA
Tropical Japonica	504	38.90%	60.50%	0.60%	0.00%	NA
Japonica Intermediate	241	62.70%	37.30%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122487318	G -> A	LOC_Os11g37910.1	upstream_gene_variant ; 1845.0bp to feature; MODIFIER	silent_mutation	Average:34.607; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg1122487318	G -> A	LOC_Os11g37920.1	upstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:34.607; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg1122487318	G -> A	LOC_Os11g37900-LOC_Os11g37910	intergenic_region ; MODIFIER	silent_mutation	Average:34.607; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122487318	2.50E-06	5.58E-09	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	9.12E-07	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	6.43E-06	6.43E-06	mr1576	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	8.53E-06	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	5.59E-07	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	3.40E-06	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	3.44E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	6.64E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	4.78E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	1.47E-08	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487318	NA	8.00E-08	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251