\
| Variant ID: vg1122485909 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22485909 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACCTGATGTCCAATAAAAAATAAATCCGAACGGATGGGAGTTAATTATAGGACAGCTCGTGTGATTTATCAATCATCAGTTGGGGTCGGGAATTGGGAT[A/T]
GCTGGTATCAATCTTCACTCCCCATTCTTTTCTCCAACAAAAGTTAGATAAACTTTTGGATACTCGTGACAAGCTTTTCAAACTGCTAGACGGTGTGTTT
AAACACACCGTCTAGCAGTTTGAAAAGCTTGTCACGAGTATCCAAAAGTTTATCTAACTTTTGTTGGAGAAAAGAATGGGGAGTGAAGATTGATACCAGC[T/A]
ATCCCAATTCCCGACCCCAACTGATGATTGATAAATCACACGAGCTGTCCTATAATTAACTCCCATCCGTTCGGATTTATTTTTTATTGGACATCAGGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 19.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.80% | 17.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 51.90% | 48.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.60% | 30.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.00% | 56.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122485909 | A -> T | LOC_Os11g37910.1 | upstream_gene_variant ; 3254.0bp to feature; MODIFIER | silent_mutation | Average:36.184; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg1122485909 | A -> T | LOC_Os11g37900-LOC_Os11g37910 | intergenic_region ; MODIFIER | silent_mutation | Average:36.184; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122485909 | 2.77E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 9.77E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 6.51E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 2.03E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 9.03E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 8.95E-09 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 2.74E-06 | NA | mr1841_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 1.20E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485909 | 7.23E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |