Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122485586:

Variant ID: vg1122485586 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22485586
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.23, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGAATAATCACATTTTTTTATTGAGTAGAGTATATTGTTGTCGTGTCGACATGGTTCGGATCAGAAAGGAGAAAAAAAAGATTCAGGTGGTGTTCTT[T/A]
TCTCCTGAAGATGAATATGAAGATGAAGATTAAGTTTTTTTACATAAAACAATATGGTATTAACGTATGACTGATTGAGTTTTAATTATTACAAACTTAA

Reverse complement sequence

TTAAGTTTGTAATAATTAAAACTCAATCAGTCATACGTTAATACCATATTGTTTTATGTAAAAAAACTTAATCTTCATCTTCATATTCATCTTCAGGAGA[A/T]
AAGAACACCACCTGAATCTTTTTTTTCTCCTTTCTGATCCGAACCATGTCGACACGACAACAATATACTCTACTCAATAAAAAAATGTGATTATTCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.90%	19.20%	6.60%	46.28%	NA
All Indica	2759	12.50%	7.50%	8.74%	71.33%	NA
All Japonica	1512	49.10%	43.40%	1.19%	6.28%	NA
Aus	269	69.10%	10.80%	17.47%	2.60%	NA
Indica I	595	1.70%	0.30%	4.54%	93.45%	NA
Indica II	465	22.40%	2.60%	3.66%	71.40%	NA
Indica III	913	13.40%	17.30%	13.80%	55.53%	NA
Indica Intermediate	786	13.70%	4.30%	9.03%	72.90%	NA
Temperate Japonica	767	44.90%	48.00%	1.69%	5.48%	NA
Tropical Japonica	504	60.90%	30.40%	0.40%	8.33%	NA
Japonica Intermediate	241	38.20%	56.00%	1.24%	4.56%	NA
VI/Aromatic	96	13.50%	8.30%	1.04%	77.08%	NA
Intermediate	90	35.60%	11.10%	5.56%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122485586	T -> A	LOC_Os11g37910.1	upstream_gene_variant ; 3577.0bp to feature; MODIFIER	silent_mutation	Average:33.857; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1122485586	T -> A	LOC_Os11g37900-LOC_Os11g37910	intergenic_region ; MODIFIER	silent_mutation	Average:33.857; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1122485586	T -> DEL	N	N	silent_mutation	Average:33.857; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122485586	9.84E-09	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	1.99E-07	NA	mr1309	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	8.58E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	4.94E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	8.09E-06	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	1.12E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	6.57E-06	NA	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	1.08E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122485586	1.34E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251