| Variant ID: vg1122485586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22485586 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.23, others allele: 0.00, population size: 99. )
GAAAGAATAATCACATTTTTTTATTGAGTAGAGTATATTGTTGTCGTGTCGACATGGTTCGGATCAGAAAGGAGAAAAAAAAGATTCAGGTGGTGTTCTT[T/A]
TCTCCTGAAGATGAATATGAAGATGAAGATTAAGTTTTTTTACATAAAACAATATGGTATTAACGTATGACTGATTGAGTTTTAATTATTACAAACTTAA
TTAAGTTTGTAATAATTAAAACTCAATCAGTCATACGTTAATACCATATTGTTTTATGTAAAAAAACTTAATCTTCATCTTCATATTCATCTTCAGGAGA[A/T]
AAGAACACCACCTGAATCTTTTTTTTCTCCTTTCTGATCCGAACCATGTCGACACGACAACAATATACTCTACTCAATAAAAAAATGTGATTATTCTTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.90% | 19.20% | 6.60% | 46.28% | NA |
| All Indica | 2759 | 12.50% | 7.50% | 8.74% | 71.33% | NA |
| All Japonica | 1512 | 49.10% | 43.40% | 1.19% | 6.28% | NA |
| Aus | 269 | 69.10% | 10.80% | 17.47% | 2.60% | NA |
| Indica I | 595 | 1.70% | 0.30% | 4.54% | 93.45% | NA |
| Indica II | 465 | 22.40% | 2.60% | 3.66% | 71.40% | NA |
| Indica III | 913 | 13.40% | 17.30% | 13.80% | 55.53% | NA |
| Indica Intermediate | 786 | 13.70% | 4.30% | 9.03% | 72.90% | NA |
| Temperate Japonica | 767 | 44.90% | 48.00% | 1.69% | 5.48% | NA |
| Tropical Japonica | 504 | 60.90% | 30.40% | 0.40% | 8.33% | NA |
| Japonica Intermediate | 241 | 38.20% | 56.00% | 1.24% | 4.56% | NA |
| VI/Aromatic | 96 | 13.50% | 8.30% | 1.04% | 77.08% | NA |
| Intermediate | 90 | 35.60% | 11.10% | 5.56% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122485586 | T -> A | LOC_Os11g37910.1 | upstream_gene_variant ; 3577.0bp to feature; MODIFIER | silent_mutation | Average:33.857; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1122485586 | T -> A | LOC_Os11g37900-LOC_Os11g37910 | intergenic_region ; MODIFIER | silent_mutation | Average:33.857; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1122485586 | T -> DEL | N | N | silent_mutation | Average:33.857; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122485586 | 9.84E-09 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 1.99E-07 | NA | mr1309 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 8.58E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 4.94E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 8.09E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 1.12E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 6.57E-06 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 1.08E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122485586 | 1.34E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |