\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122484031:

Variant ID: vg1122484031 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22484031
Reference Allele: AAlternative Allele: G,ACCCGGGTGGATTG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCTATCCCTATGAGCACCTCTGTCTTAGAATACATGCATCGACTATCACTAAAAGAATAATTAGCCGTAAATGTGAGCACTAGTGTCAAGTCTAGAATTT[A/G,ACCCGGGTGGATTG]
TACCCGGGTGGATTGGTTCCACCACAAATAACTTAGTTTTAAAGTATACTATAATGATAGTACTTGCCAGTATAATTCTAATCATAGGATTTTAGTGTTA

Reverse complement sequence

TAACACTAAAATCCTATGATTAGAATTATACTGGCAAGTACTATCATTATAGTATACTTTAAAACTAAGTTATTTGTGGTGGAACCAATCCACCCGGGTA[T/C,CAATCCACCCGGGT]
AAATTCTAGACTTGACACTAGTGCTCACATTTACGGCTAATTATTCTTTTAGTGATAGTCGATGCATGTATTCTAAGACAGAGGTGCTCATAGGGATAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.20% 0.11% 0.00% ACCCGGGTGGATTG: 0.13%
All Indica  2759 95.40% 4.30% 0.07% 0.00% ACCCGGGTGGATTG: 0.22%
All Japonica  1512 13.10% 86.80% 0.07% 0.00% NA
Aus  269 31.20% 68.40% 0.37% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 93.30% 6.40% 0.00% 0.00% ACCCGGGTGGATTG: 0.33%
Indica Intermediate  786 94.00% 5.50% 0.13% 0.00% ACCCGGGTGGATTG: 0.38%
Temperate Japonica  767 10.30% 89.60% 0.13% 0.00% NA
Tropical Japonica  504 14.30% 85.70% 0.00% 0.00% NA
Japonica Intermediate  241 19.50% 80.50% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122484031 A -> ACCCGGGTGGATTG LOC_Os11g37900-LOC_Os11g37910 intergenic_region ; MODIFIER silent_mutation Average:53.483; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N
vg1122484031 A -> G LOC_Os11g37900-LOC_Os11g37910 intergenic_region ; MODIFIER silent_mutation Average:53.483; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122484031 NA 3.17E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.03E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 4.44E-08 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 4.20E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.02E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 8.58E-07 2.42E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.78E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.05E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 6.57E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 9.62E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 6.60E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 6.43E-06 6.43E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 3.08E-24 mr1913 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.63E-10 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.67E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 5.34E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.79E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 2.38E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 3.34E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 5.71E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.13E-16 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 8.67E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 2.68E-36 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122484031 NA 1.70E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251