Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122476819:

Variant ID: vg1122476819 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22476819
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCGGCTTTCCTCCTCGCCACTAGTACCAAATTCCTCCTCGCCACGTGTACCAAACACATACCCGTCGATTCCGATTGGTATCACAGTCTGATACCAAG[C/T]
TAGAAAGCATTGCATCATACCTCGTAAGTATTATCGGATATCTTACTTGTATCATATAATACTCACAGGAATAAGAACATTATACTGACCAGTTATCAAA

Reverse complement sequence

TTTGATAACTGGTCAGTATAATGTTCTTATTCCTGTGAGTATTATATGATACAAGTAAGATATCCGATAATACTTACGAGGTATGATGCAATGCTTTCTA[G/A]
CTTGGTATCAGACTGTGATACCAATCGGAATCGACGGGTATGTGTTTGGTACACGTGGCGAGGAGGAATTTGGTACTAGTGGCGAGGAGGAAAGCCGGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	3.60%	0.02%	0.00%	NA
All Indica	2759	94.50%	5.50%	0.00%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	83.00%	17.00%	0.00%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122476819	C -> T	LOC_Os11g37900-LOC_Os11g37910	intergenic_region ; MODIFIER	silent_mutation	Average:53.735; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122476819	NA	1.46E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	6.36E-08	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	1.49E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	8.96E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	7.31E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	1.40E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	4.71E-06	NA	mr1889	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	1.82E-07	1.74E-11	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	8.21E-07	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	1.13E-06	6.72E-09	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	4.41E-09	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	2.39E-06	NA	mr1907	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	7.09E-07	1.84E-12	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	2.41E-06	5.47E-12	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	1.33E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	1.61E-08	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	4.98E-07	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	8.18E-07	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	7.93E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	9.74E-07	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	3.85E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	1.58E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122476819	NA	5.68E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251