\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122467523:

Variant ID: vg1122467523 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22467523
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTATACTTACAATTTTTTATATGTATACACTTTATTATATAAAAAATATATACGTATACAAAGTTTGTGTACATACATATAAAAATAAAAAAAAACA[C/T,A]
TTATACAAACTTTGTATACATATATACAAAGTTTGTGTACATACATATAAAAATAAAAATAAAAACACTTATACAAACTTTGTATATGTGTATAAAAAGT

Reverse complement sequence

ACTTTTTATACACATATACAAAGTTTGTATAAGTGTTTTTATTTTTATTTTTATATGTATGTACACAAACTTTGTATATATGTATACAAAGTTTGTATAA[G/A,T]
TGTTTTTTTTTATTTTTATATGTATGTACACAAACTTTGTATACGTATATATTTTTTATATAATAAAGTGTATACATATAAAAAATTGTAAGTATAAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.10% 0.08% 0.57% A: 0.02%
All Indica  2759 94.60% 5.00% 0.04% 0.25% A: 0.04%
All Japonica  1512 97.00% 1.90% 0.07% 1.06% NA
Aus  269 24.50% 73.60% 0.74% 1.12% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 89.60% 10.20% 0.00% 0.11% A: 0.11%
Indica Intermediate  786 94.30% 5.10% 0.13% 0.51% NA
Temperate Japonica  767 96.00% 2.00% 0.00% 2.09% NA
Tropical Japonica  504 97.40% 2.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122467523 C -> T LOC_Os11g37890.1 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> T LOC_Os11g37890.3 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> T LOC_Os11g37890.2 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> T LOC_Os11g37900.1 downstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> T LOC_Os11g37890-LOC_Os11g37900 intergenic_region ; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> A LOC_Os11g37890.1 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> A LOC_Os11g37890.3 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> A LOC_Os11g37890.2 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> A LOC_Os11g37900.1 downstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> A LOC_Os11g37890-LOC_Os11g37900 intergenic_region ; MODIFIER silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N
vg1122467523 C -> DEL N N silent_mutation Average:78.526; most accessible tissue: Callus, score: 94.678 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122467523 C A 0.0 0.0 0.0 -0.02 -0.01 0.0
vg1122467523 C T 0.01 0.01 0.01 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122467523 NA 2.25E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122467523 NA 2.33E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122467523 NA 4.83E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122467523 3.34E-06 NA mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251