\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122466711:

Variant ID: vg1122466711 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22466711
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTATCACAAGCTATAAGACAAATACATTAAATGTATAAGTGAGAGATAGAGAGAGGAGAAGAAAATTATAGCCAATCTTATAGCTAATATATTATATAT[A/G]
TTGGCTTTAAAGATGGGCTAATAGTAGAAATTTGGCTATATTATTATCCTTGCTCTAACTGACATTACATAAAAGTACGTACACCTCATAATTTGATCAA

Reverse complement sequence

TTGATCAAATTATGAGGTGTACGTACTTTTATGTAATGTCAGTTAGAGCAAGGATAATAATATAGCCAAATTTCTACTATTAGCCCATCTTTAAAGCCAA[T/C]
ATATATAATATATTAGCTATAAGATTGGCTATAATTTTCTTCTCCTCTCTCTATCTCTCACTTATACATTTAATGTATTTGTCTTATAGCTTGTGATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.00% 0.02% 0.57% NA
All Indica  2759 98.60% 1.10% 0.04% 0.25% NA
All Japonica  1512 24.20% 74.70% 0.00% 1.06% NA
Aus  269 97.40% 1.50% 0.00% 1.12% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.60% 1.90% 0.00% 0.43% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 97.80% 1.50% 0.13% 0.51% NA
Temperate Japonica  767 19.20% 78.70% 0.00% 2.09% NA
Tropical Japonica  504 22.00% 78.00% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122466711 A -> DEL N N silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg1122466711 A -> G LOC_Os11g37890.1 upstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg1122466711 A -> G LOC_Os11g37890.3 upstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg1122466711 A -> G LOC_Os11g37890.2 upstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg1122466711 A -> G LOC_Os11g37900.1 downstream_gene_variant ; 1542.0bp to feature; MODIFIER silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg1122466711 A -> G LOC_Os11g37890-LOC_Os11g37900 intergenic_region ; MODIFIER silent_mutation Average:85.911; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122466711 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122466711 9.55E-08 NA mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 1.10E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 5.74E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 2.74E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 7.68E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 9.93E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 8.72E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 2.04E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 1.27E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 2.47E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 1.01E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 9.31E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 3.06E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466711 NA 8.46E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251