\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122466562:

Variant ID: vg1122466562 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22466562
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: ATG

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTTTTATCTTATTAAAATATATTTACAGCTGGCTAATAGCCTGCTATTGTACCTGCTCTAATAATGAGCTATAAGCTTACTATAAGCTTAGGTGAAG[A/G,ATG]
AGAGAGATAGTGAAAAATTAAGGATGTTGGCTCTTATGCAAGAGCTAGCTTATCACAAGCTATAAGACAAATACATTAAATGTATAAGTGAGAGATAGAG

Reverse complement sequence

CTCTATCTCTCACTTATACATTTAATGTATTTGTCTTATAGCTTGTGATAAGCTAGCTCTTGCATAAGAGCCAACATCCTTAATTTTTCACTATCTCTCT[T/C,CAT]
CTTCACCTAAGCTTATAGTAAGCTTATAGCTCATTATTAGAGCAGGTACAATAGCAGGCTATTAGCCAGCTGTAAATATATTTTAATAAGATAAAAGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of ATG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 18.60% 0.17% 0.57% G: 6.43%
All Indica  2759 77.50% 20.40% 0.14% 0.25% G: 1.70%
All Japonica  1512 82.10% 5.40% 0.26% 1.06% G: 11.24%
Aus  269 23.00% 75.50% 0.00% 1.12% G: 0.37%
Indica I  595 87.90% 12.10% 0.00% 0.00% NA
Indica II  465 71.40% 27.50% 0.43% 0.43% G: 0.22%
Indica III  913 74.30% 21.10% 0.11% 0.11% G: 4.38%
Indica Intermediate  786 77.00% 21.60% 0.13% 0.51% G: 0.76%
Temperate Japonica  767 84.70% 2.60% 0.39% 2.09% G: 10.17%
Tropical Japonica  504 82.70% 10.70% 0.00% 0.00% G: 6.55%
Japonica Intermediate  241 72.20% 2.90% 0.41% 0.00% G: 24.48%
VI/Aromatic  96 16.70% 9.40% 0.00% 0.00% G: 73.96%
Intermediate  90 57.80% 24.40% 0.00% 1.11% G: 16.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122466562 A -> ATG LOC_Os11g37890.1 upstream_gene_variant ; 1882.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> ATG LOC_Os11g37890.3 upstream_gene_variant ; 1882.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> ATG LOC_Os11g37890.2 upstream_gene_variant ; 1882.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> ATG LOC_Os11g37900.1 downstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> ATG LOC_Os11g37890-LOC_Os11g37900 intergenic_region ; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> DEL N N silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> G LOC_Os11g37890.1 upstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> G LOC_Os11g37890.3 upstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> G LOC_Os11g37890.2 upstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> G LOC_Os11g37900.1 downstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N
vg1122466562 A -> G LOC_Os11g37890-LOC_Os11g37900 intergenic_region ; MODIFIER silent_mutation Average:87.417; most accessible tissue: Minghui63 young leaf, score: 96.235 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122466562 A ATG 0.38 0.17 0.12 0.03 0.11 0.17
vg1122466562 A G 0.01 0.01 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122466562 NA 1.69E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 NA 4.07E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 NA 2.70E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 NA 4.04E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 3.33E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 NA 5.20E-06 mr1640 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122466562 3.96E-07 3.96E-07 mr1849 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251