\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122459143:

Variant ID: vg1122459143 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22459143
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.45, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTCTATATACTAACCCACATCACAGCAGTCAAACACAAATTTATGGTGCATAATTGGTTTTGTAGATACATGGTTGGATTGAGGGTGCGCTCGTTTC[T/A]
GTAGATAGGTTGGGCTGATTAGCCGCACGTAAAATGAGAAATGTGATTAGCATATGATTAATTTGTGTTAATATATTTTTGATAAATAAATTTGTTGGAT

Reverse complement sequence

ATCCAACAAATTTATTTATCAAAAATATATTAACACAAATTAATCATATGCTAATCACATTTCTCATTTTACGTGCGGCTAATCAGCCCAACCTATCTAC[A/T]
GAAACGAGCGCACCCTCAATCCAACCATGTATCTACAAAACCAATTATGCACCATAAATTTGTGTTTGACTGCTGTGATGTGGGTTAGTATATAGAATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.50% 0.11% 0.00% NA
All Indica  2759 58.90% 41.00% 0.14% 0.00% NA
All Japonica  1512 78.30% 21.70% 0.00% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 81.30% 18.50% 0.17% 0.00% NA
Indica II  465 52.90% 46.70% 0.43% 0.00% NA
Indica III  913 47.50% 52.50% 0.00% 0.00% NA
Indica Intermediate  786 58.70% 41.20% 0.13% 0.00% NA
Temperate Japonica  767 83.60% 16.40% 0.00% 0.00% NA
Tropical Japonica  504 79.80% 20.20% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122459143 T -> A LOC_Os11g37880.1 downstream_gene_variant ; 577.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 root, score: 87.187 N N N N
vg1122459143 T -> A LOC_Os11g37890.1 downstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 root, score: 87.187 N N N N
vg1122459143 T -> A LOC_Os11g37890.3 downstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 root, score: 87.187 N N N N
vg1122459143 T -> A LOC_Os11g37890.2 downstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 root, score: 87.187 N N N N
vg1122459143 T -> A LOC_Os11g37880-LOC_Os11g37890 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 root, score: 87.187 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122459143 T A -0.01 0.0 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122459143 5.08E-06 NA mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 5.47E-06 1.22E-09 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 NA 2.36E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 NA 2.75E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 NA 7.73E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 8.65E-06 3.98E-06 mr1888 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122459143 NA 9.35E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251