\
| Variant ID: vg1122458810 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22458810 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.45, T: 0.02, others allele: 0.00, population size: 88. )
ATTAAGTTTCTTAATAAAACGAATGGTCAAACATATGTTCAAAACAGAAGTCGCATCGTGTGTAGCTTGGTTTCTTTTTACTTGTTTTCGTTTCTGTTTT[A/G]
TGTAAAAGGCTCAGTTTTTAGCTTTCTCAAAAAAAAGCAGGGTAATGAAAAGTTGTGCATCAAACATAAAACCGGATTGAAAACTATTTTGCACCATATT
AATATGGTGCAAAATAGTTTTCAATCCGGTTTTATGTTTGATGCACAACTTTTCATTACCCTGCTTTTTTTTGAGAAAGCTAAAAACTGAGCCTTTTACA[T/C]
AAAACAGAAACGAAAACAAGTAAAAAGAAACCAAGCTACACACGATGCGACTTCTGTTTTGAACATATGTTTGACCATTCGTTTTATTAAGAAACTTAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 38.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 58.90% | 40.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.20% | 18.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 52.90% | 46.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 47.50% | 52.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 58.90% | 40.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.50% | 41.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122458810 | A -> G | LOC_Os11g37880.1 | downstream_gene_variant ; 244.0bp to feature; MODIFIER | silent_mutation | Average:50.815; most accessible tissue: Callus, score: 77.686 | N | N | N | N |
| vg1122458810 | A -> G | LOC_Os11g37890.1 | downstream_gene_variant ; 990.0bp to feature; MODIFIER | silent_mutation | Average:50.815; most accessible tissue: Callus, score: 77.686 | N | N | N | N |
| vg1122458810 | A -> G | LOC_Os11g37890.3 | downstream_gene_variant ; 990.0bp to feature; MODIFIER | silent_mutation | Average:50.815; most accessible tissue: Callus, score: 77.686 | N | N | N | N |
| vg1122458810 | A -> G | LOC_Os11g37890.2 | downstream_gene_variant ; 2235.0bp to feature; MODIFIER | silent_mutation | Average:50.815; most accessible tissue: Callus, score: 77.686 | N | N | N | N |
| vg1122458810 | A -> G | LOC_Os11g37880-LOC_Os11g37890 | intergenic_region ; MODIFIER | silent_mutation | Average:50.815; most accessible tissue: Callus, score: 77.686 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122458810 | 3.40E-06 | 3.57E-12 | mr1170 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | 7.32E-06 | 1.35E-09 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | NA | 7.56E-08 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | NA | 7.03E-07 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | NA | 3.54E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | NA | 9.75E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122458810 | NA | 5.24E-09 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |