\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122450251:

Variant ID: vg1122450251 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22450251
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGTCATCCTTTCTTTTTCTAATAAACTAGAAAAAATACCCGTGCATTACAGCGGGTGAAGACTATTTTAGTTTTATTATTATTGTTATACGATTTAG[T/C]
TAGGGTGAAAATCATTGTGGGAATTTACTTGGATATTTTTTTTAGAAAATCATGAGTTGTAATTAGGAGTTCGACTCTTATCTCAAGTTAGCATCTCAAG

Reverse complement sequence

CTTGAGATGCTAACTTGAGATAAGAGTCGAACTCCTAATTACAACTCATGATTTTCTAAAAAAAATATCCAAGTAAATTCCCACAATGATTTTCACCCTA[A/G]
CTAAATCGTATAACAATAATAATAAAACTAAAATAGTCTTCACCCGCTGTAATGCACGGGTATTTTTTCTAGTTTATTAGAAAAAGAAAGGATGACAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 17.60% 0.21% 6.77% NA
All Indica  2759 99.10% 0.60% 0.00% 0.25% NA
All Japonica  1512 25.80% 53.20% 0.53% 20.44% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.00% 0.00% 0.64% NA
Temperate Japonica  767 21.50% 67.70% 0.13% 10.69% NA
Tropical Japonica  504 22.60% 46.40% 0.79% 30.16% NA
Japonica Intermediate  241 46.10% 21.60% 1.24% 31.12% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 10.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122450251 T -> DEL N N silent_mutation Average:43.602; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1122450251 T -> C LOC_Os11g37880.1 upstream_gene_variant ; 1385.0bp to feature; MODIFIER silent_mutation Average:43.602; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1122450251 T -> C LOC_Os11g37870.1 downstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:43.602; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1122450251 T -> C LOC_Os11g37870-LOC_Os11g37880 intergenic_region ; MODIFIER silent_mutation Average:43.602; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122450251 4.12E-06 4.12E-06 mr1333 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122450251 NA 6.48E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122450251 NA 5.62E-06 mr1928 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251