\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122448541:

Variant ID: vg1122448541 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22448541
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAGCTTCATGTTCCACCTAATTAATCCTTTAATGAATTATGATAATAGATATGCAATTTCAAAAACGCCTTATTTTACTTATTTTTACTTTCAATTC[G/A]
TTGACATGTTTTTAAAAAATAAGTCTACCTTAATTTCAAATGATATAGAAGATTATAAAAAATTACTTATAGATATTATTTAAATATTGATACAATATAA

Reverse complement sequence

TTATATTGTATCAATATTTAAATAATATCTATAAGTAATTTTTTATAATCTTCTATATCATTTGAAATTAAGGTAGACTTATTTTTTAAAAACATGTCAA[C/T]
GAATTGAAAGTAAAAATAAGTAAAATAAGGCGTTTTTGAAATTGCATATCTATTATCATAATTCATTAAAGGATTAATTAGGTGGAACATGAAGCTCTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.20% 1.42% 0.00% NA
All Indica  2759 97.90% 2.00% 0.14% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 92.70% 6.90% 0.43% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.20% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 43.80% 0.00% 56.25% 0.00% NA
Intermediate  90 94.40% 0.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122448541 G -> A LOC_Os11g37880.1 upstream_gene_variant ; 3095.0bp to feature; MODIFIER silent_mutation Average:22.401; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1122448541 G -> A LOC_Os11g37870.1 downstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:22.401; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1122448541 G -> A LOC_Os11g37870-LOC_Os11g37880 intergenic_region ; MODIFIER silent_mutation Average:22.401; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122448541 NA 4.03E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 2.45E-06 3.75E-12 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 7.89E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 1.40E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 1.23E-13 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 6.81E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 1.93E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 8.47E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 1.76E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 4.13E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 2.06E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 NA 3.51E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122448541 3.86E-06 3.86E-06 mr1991_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251