\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122447657:

Variant ID: vg1122447657 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22447657
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGTGTGTTGTGCAAATACATTCTATACATTTTTTTAAAAAAAAACTATTTTCATGTTTGTAATATTTAATACTTAATTAATCATACGTTAATAGCCT[A/G]
TATTGTTTTGTGTGCCCTACATAAGCTCAATCAATGAGATCGAGTGTACCCTAAGTAGGAGATAAATTAGATTATTTACTATAAAATTTAAAATTAAAGA

Reverse complement sequence

TCTTTAATTTTAAATTTTATAGTAAATAATCTAATTTATCTCCTACTTAGGGTACACTCGATCTCATTGATTGAGCTTATGTAGGGCACACAAAACAATA[T/C]
AGGCTATTAACGTATGATTAATTAAGTATTAAATATTACAAACATGAAAATAGTTTTTTTTTAAAAAAATGTATAGAATGTATTTGCACAACACACACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 5.40% 2.35% 0.85% NA
All Indica  2759 90.80% 4.00% 3.81% 1.41% NA
All Japonica  1512 95.70% 4.00% 0.33% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.50% 0.80% 1.01% 0.67% NA
Indica II  465 91.60% 6.70% 1.72% 0.00% NA
Indica III  913 84.30% 4.90% 7.67% 3.07% NA
Indica Intermediate  786 92.70% 3.70% 2.67% 0.89% NA
Temperate Japonica  767 99.10% 0.70% 0.26% 0.00% NA
Tropical Japonica  504 95.20% 4.20% 0.60% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122447657 A -> DEL N N silent_mutation Average:24.353; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1122447657 A -> G LOC_Os11g37880.1 upstream_gene_variant ; 3979.0bp to feature; MODIFIER silent_mutation Average:24.353; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1122447657 A -> G LOC_Os11g37870.1 downstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:24.353; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1122447657 A -> G LOC_Os11g37870-LOC_Os11g37880 intergenic_region ; MODIFIER silent_mutation Average:24.353; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122447657 NA 2.20E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 5.61E-06 9.10E-08 mr1122 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 2.42E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 4.58E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 8.32E-07 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 2.96E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 4.63E-06 4.62E-06 mr1239 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 2.14E-06 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 5.09E-06 1.32E-08 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 1.53E-09 9.09E-12 mr1377 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 6.04E-09 6.04E-09 mr1377 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 1.11E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 2.87E-11 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 7.81E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 9.57E-07 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 2.32E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 3.76E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 8.38E-06 mr1746 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 NA 6.14E-06 mr1768 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447657 6.35E-06 6.35E-06 mr1849 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251