\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122447036:

Variant ID: vg1122447036 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22447036
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTACACGTACGTACTACTGGAAAAAAAATTTAAAAAAAACATCGCTTTTTCTAAACTTGGATTTTCACTTCCTTTGTATTTTTTTTATGACAGCCAAC[G/A]
TTAAATATTTAGTGAAACTACCGAAAGAAAACAACGCTCTTTAATCTGGATTTTCTATTATACTTCCTTTGTATTTTTTTATTGTTTTTTATATATTGAT

Reverse complement sequence

ATCAATATATAAAAAACAATAAAAAAATACAAAGGAAGTATAATAGAAAATCCAGATTAAAGAGCGTTGTTTTCTTTCGGTAGTTTCACTAAATATTTAA[C/T]
GTTGGCTGTCATAAAAAAAATACAAAGGAAGTGAAAATCCAAGTTTAGAAAAAGCGATGTTTTTTTTAAATTTTTTTTCCAGTAGTACGTACGTGTACAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 1.20% 1.74% 0.00% NA
All Indica  2759 95.10% 2.10% 2.83% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 83.20% 7.50% 9.25% 0.00% NA
Indica III  913 98.60% 0.40% 0.99% 0.00% NA
Indica Intermediate  786 94.50% 2.30% 3.18% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122447036 G -> A LOC_Os11g37880.1 upstream_gene_variant ; 4600.0bp to feature; MODIFIER silent_mutation Average:22.761; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N
vg1122447036 G -> A LOC_Os11g37870.1 downstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:22.761; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N
vg1122447036 G -> A LOC_Os11g37870-LOC_Os11g37880 intergenic_region ; MODIFIER silent_mutation Average:22.761; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122447036 NA 1.77E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 5.23E-09 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 5.31E-07 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 3.96E-06 3.96E-06 mr1576 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 2.31E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 8.63E-08 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 1.83E-07 3.31E-13 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 2.02E-07 1.40E-11 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 7.94E-07 3.67E-13 mr1903 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 1.07E-07 6.12E-16 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 5.19E-07 5.19E-07 mr1926 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 2.46E-12 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 2.33E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 1.13E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122447036 NA 1.96E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251