| Variant ID: vg1122446629 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22446629 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTATCCATTGCTTCGCTTTCTTACCATCAATCTATCTATCTATTATCTACTCTATTATACCCTAAAAGAACATTAAATTTCCTACAAACGCTCTCATGC[C/T]
GCCATATGGTGCTCTAAAAAGCTCTCAAGCTGCCACAAGGCGCTATAATAAAATAGAAAAAAACTTAAAATTTCTGAGAAAAAAGAAAAAAAATATATCC
GGATATATTTTTTTTCTTTTTTCTCAGAAATTTTAAGTTTTTTTCTATTTTATTATAGCGCCTTGTGGCAGCTTGAGAGCTTTTTAGAGCACCATATGGC[G/A]
GCATGAGAGCGTTTGTAGGAAATTTAATGTTCTTTTAGGGTATAATAGAGTAGATAATAGATAGATAGATTGATGGTAAGAAAGCGAAGCAATGGATAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.70% | 1.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 6.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122446629 | C -> T | LOC_Os11g37870.1 | downstream_gene_variant ; 1236.0bp to feature; MODIFIER | silent_mutation | Average:37.601; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1122446629 | C -> T | LOC_Os11g37870-LOC_Os11g37880 | intergenic_region ; MODIFIER | silent_mutation | Average:37.601; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122446629 | NA | 2.63E-06 | mr1030 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | 4.83E-06 | 4.83E-06 | mr1046 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | 4.63E-06 | 4.63E-06 | mr1048 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | 3.10E-06 | 3.10E-06 | mr1054 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | NA | 3.27E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | 4.75E-06 | 1.32E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | NA | 5.26E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | NA | 1.16E-08 | mr1122 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | NA | 8.44E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446629 | NA | 9.39E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/