\
| Variant ID: vg1122446280 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22446280 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCTATTGTCTACCAGCAGTCCAGTATGATTAGTATACGTTTGATCAGTTGGATAGTTGAGAAGAGTATTAGAACAATATATTGACACATCTAAATATTT[T/C]
GAATAAATGATAGATATATATTAAATGTTTAATTACAGTATAATTTAGATTAGTTGTATATATAACATAATCGTTTAATGGAAACCTACCTATATTCTAT
ATAGAATATAGGTAGGTTTCCATTAAACGATTATGTTATATATACAACTAATCTAAATTATACTGTAATTAAACATTTAATATATATCTATCATTTATTC[A/G]
AAATATTTAGATGTGTCAATATATTGTTCTAATACTCTTCTCAACTATCCAACTGATCAAACGTATACTAATCATACTGGACTGCTGGTAGACAATAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 26.20% | 13.27% | 5.80% | NA |
| All Indica | 2759 | 70.10% | 8.80% | 13.74% | 7.32% | NA |
| All Japonica | 1512 | 23.10% | 58.00% | 14.55% | 4.37% | NA |
| Aus | 269 | 85.50% | 8.60% | 5.58% | 0.37% | NA |
| Indica I | 595 | 86.10% | 3.50% | 6.22% | 4.20% | NA |
| Indica II | 465 | 75.10% | 2.40% | 17.63% | 4.95% | NA |
| Indica III | 913 | 58.30% | 16.40% | 14.35% | 10.95% | NA |
| Indica Intermediate | 786 | 69.00% | 7.80% | 16.41% | 6.87% | NA |
| Temperate Japonica | 767 | 13.40% | 69.10% | 16.82% | 0.65% | NA |
| Tropical Japonica | 504 | 31.50% | 51.40% | 8.53% | 8.53% | NA |
| Japonica Intermediate | 241 | 36.10% | 36.50% | 19.92% | 7.47% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 21.10% | 14.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122446280 | T -> DEL | N | N | silent_mutation | Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122446280 | T -> C | LOC_Os11g37870.1 | downstream_gene_variant ; 887.0bp to feature; MODIFIER | silent_mutation | Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122446280 | T -> C | LOC_Os11g37870-LOC_Os11g37880 | intergenic_region ; MODIFIER | silent_mutation | Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122446280 | 5.74E-06 | 5.74E-06 | mr1333 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122446280 | NA | 3.92E-06 | mr1928 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |