Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122446280:

Variant ID: vg1122446280 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22446280
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTATTGTCTACCAGCAGTCCAGTATGATTAGTATACGTTTGATCAGTTGGATAGTTGAGAAGAGTATTAGAACAATATATTGACACATCTAAATATTT[T/C]
GAATAAATGATAGATATATATTAAATGTTTAATTACAGTATAATTTAGATTAGTTGTATATATAACATAATCGTTTAATGGAAACCTACCTATATTCTAT

Reverse complement sequence

ATAGAATATAGGTAGGTTTCCATTAAACGATTATGTTATATATACAACTAATCTAAATTATACTGTAATTAAACATTTAATATATATCTATCATTTATTC[A/G]
AAATATTTAGATGTGTCAATATATTGTTCTAATACTCTTCTCAACTATCCAACTGATCAAACGTATACTAATCATACTGGACTGCTGGTAGACAATAGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	26.20%	13.27%	5.80%	NA
All Indica	2759	70.10%	8.80%	13.74%	7.32%	NA
All Japonica	1512	23.10%	58.00%	14.55%	4.37%	NA
Aus	269	85.50%	8.60%	5.58%	0.37%	NA
Indica I	595	86.10%	3.50%	6.22%	4.20%	NA
Indica II	465	75.10%	2.40%	17.63%	4.95%	NA
Indica III	913	58.30%	16.40%	14.35%	10.95%	NA
Indica Intermediate	786	69.00%	7.80%	16.41%	6.87%	NA
Temperate Japonica	767	13.40%	69.10%	16.82%	0.65%	NA
Tropical Japonica	504	31.50%	51.40%	8.53%	8.53%	NA
Japonica Intermediate	241	36.10%	36.50%	19.92%	7.47%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	21.10%	14.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122446280	T -> DEL	N	N	silent_mutation	Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1122446280	T -> C	LOC_Os11g37870.1	downstream_gene_variant ; 887.0bp to feature; MODIFIER	silent_mutation	Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1122446280	T -> C	LOC_Os11g37870-LOC_Os11g37880	intergenic_region ; MODIFIER	silent_mutation	Average:22.863; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122446280	5.74E-06	5.74E-06	mr1333	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122446280	NA	3.92E-06	mr1928	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251