\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122427843:

Variant ID: vg1122427843 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22427843
Reference Allele: CAlternative Allele: A,CA,CAGCA
Primary Allele: CSecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTACGTTAATCATATCCTTCCACACACCAGCTAAGCAGCAAGCTCTCACTGCACTCACCGCATCGATCTCTACTCGATACACAGCAGCAGCAGCAGC[C/A,CA,CAGCA]
GCCTAAACCCCCATTAGCTAGCTGCATGCCTCAGCGAGCCATGGAGTCGCCTCCAATCCCCTCTTGAGACAAGCTGTGCCAAGGGCAACGAGTACAAGCC

Reverse complement sequence

GGCTTGTACTCGTTGCCCTTGGCACAGCTTGTCTCAAGAGGGGATTGGAGGCGACTCCATGGCTCGCTGAGGCATGCAGCTAGCTAATGGGGGTTTAGGC[G/T,TG,TGCTG]
GCTGCTGCTGCTGCTGTGTATCGAGTAGAGATCGATGCGGTGAGTGCAGTGAGAGCTTGCTGCTTAGCTGGTGTGTGGAAGGATATGATTAACGTAAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 28.80% 1.06% 5.14% A: 6.50%; CAGCA: 0.23%
All Indica  2759 58.20% 33.20% 1.56% 5.40% A: 1.23%; CAGCA: 0.33%
All Japonica  1512 58.90% 24.90% 0.26% 4.17% A: 11.71%
Aus  269 72.50% 16.00% 0.00% 9.67% A: 1.12%; CAGCA: 0.74%
Indica I  595 74.50% 17.30% 2.86% 5.04% A: 0.34%
Indica II  465 50.30% 44.70% 1.94% 1.72% A: 1.08%; CAGCA: 0.22%
Indica III  913 50.60% 37.70% 0.55% 8.87% A: 1.86%; CAGCA: 0.44%
Indica Intermediate  786 59.50% 33.30% 1.53% 3.82% A: 1.27%; CAGCA: 0.51%
Temperate Japonica  767 75.90% 10.70% 0.26% 2.48% A: 10.69%
Tropical Japonica  504 49.20% 36.50% 0.00% 7.94% A: 6.35%
Japonica Intermediate  241 25.30% 46.10% 0.83% 1.66% A: 26.14%
VI/Aromatic  96 15.60% 1.00% 0.00% 1.04% A: 82.29%
Intermediate  90 50.00% 26.70% 3.33% 4.44% A: 15.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122427843 C -> CA LOC_Os11g37860.1 5_prime_UTR_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> CA LOC_Os11g37850.1 downstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> A LOC_Os11g37860.1 5_prime_UTR_variant ; 572.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> A LOC_Os11g37850.1 downstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> DEL N N silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> CAGCA LOC_Os11g37860.1 5_prime_UTR_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N
vg1122427843 C -> CAGCA LOC_Os11g37850.1 downstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:73.154; most accessible tissue: Callus, score: 91.803 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122427843 C A 0.08 0.02 0.0 0.01 0.01 0.0
vg1122427843 C CA 0.27 0.06 0.0 -0.02 0.03 0.04
vg1122427843 C CAGCA 0.13 -0.05 -0.05 0.04 0.0 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122427843 2.34E-06 4.40E-07 mr1322 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427843 NA 6.66E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427843 NA 4.00E-06 mr1888 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251