\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122418019:

Variant ID: vg1122418019 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22418019
Reference Allele: CAlternative Allele: T,CCCTT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCAGCATGTCGTCTATATTATTAACCTTGCTCTAATTAAAGAAAAACAATTGCAATAACTACCACCAGCTCTATTAATTAATCTCCTCTCCTCTTCT[C/T,CCCTT]
CTCTTCTACCAGGGACATCCCCTGCGACCTTCAGCGCGGCGGCCTTGGCTTTGGCAAGCTGCGGCGGTGGCCTAGGCAGCGGAGAGCTCGAGCTCGGCCT

Reverse complement sequence

AGGCCGAGCTCGAGCTCTCCGCTGCCTAGGCCACCGCCGCAGCTTGCCAAAGCCAAGGCCGCCGCGCTGAAGGTCGCAGGGGATGTCCCTGGTAGAAGAG[G/A,AAGGG]
AGAAGAGGAGAGGAGATTAATTAATAGAGCTGGTGGTAGTTATTGCAATTGTTTTTCTTTAATTAGAGCAAGGTTAATAATATAGACGACATGCTGGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 2.50% 5.50% 62.97% CCCTT: 0.23%
All Indica  2759 12.80% 0.10% 5.55% 81.15% CCCTT: 0.40%
All Japonica  1512 58.30% 7.30% 6.22% 28.11% NA
Aus  269 6.70% 0.00% 2.97% 90.33% NA
Indica I  595 8.90% 0.20% 3.53% 86.89% CCCTT: 0.50%
Indica II  465 2.60% 0.00% 1.72% 95.48% CCCTT: 0.22%
Indica III  913 24.20% 0.20% 9.31% 65.72% CCCTT: 0.55%
Indica Intermediate  786 8.40% 0.10% 4.96% 86.26% CCCTT: 0.25%
Temperate Japonica  767 63.80% 14.30% 7.95% 13.95% NA
Tropical Japonica  504 53.80% 0.00% 2.58% 43.65% NA
Japonica Intermediate  241 50.60% 0.40% 8.30% 40.66% NA
VI/Aromatic  96 83.30% 0.00% 1.04% 15.62% NA
Intermediate  90 32.20% 3.30% 4.44% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122418019 C -> CCCTT LOC_Os11g37850.1 upstream_gene_variant ; 1248.0bp to feature; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> CCCTT LOC_Os11g37840.1 downstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> CCCTT LOC_Os11g37840-LOC_Os11g37850 intergenic_region ; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> T LOC_Os11g37850.1 upstream_gene_variant ; 1249.0bp to feature; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> T LOC_Os11g37840.1 downstream_gene_variant ; 3784.0bp to feature; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> T LOC_Os11g37840-LOC_Os11g37850 intergenic_region ; MODIFIER silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N
vg1122418019 C -> DEL N N silent_mutation Average:36.796; most accessible tissue: Callus, score: 84.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122418019 NA 1.34E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122418019 NA 2.06E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 3.62E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 4.73E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 4.97E-06 1.80E-11 mr1354 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 3.66E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 7.64E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 1.97E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 5.07E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 1.00E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 1.55E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 4.12E-06 4.12E-06 mr1181_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 3.91E-09 1.11E-15 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 4.56E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 5.05E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019 NA 1.28E-09 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251