Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122418019:

Variant ID: vg1122418019 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 22418019
Reference Allele: C	Alternative Allele: T,CCCTT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCCAGCATGTCGTCTATATTATTAACCTTGCTCTAATTAAAGAAAAACAATTGCAATAACTACCACCAGCTCTATTAATTAATCTCCTCTCCTCTTCT[C/T,CCCTT]
CTCTTCTACCAGGGACATCCCCTGCGACCTTCAGCGCGGCGGCCTTGGCTTTGGCAAGCTGCGGCGGTGGCCTAGGCAGCGGAGAGCTCGAGCTCGGCCT

Reverse complement sequence

AGGCCGAGCTCGAGCTCTCCGCTGCCTAGGCCACCGCCGCAGCTTGCCAAAGCCAAGGCCGCCGCGCTGAAGGTCGCAGGGGATGTCCCTGGTAGAAGAG[G/A,AAGGG]
AGAAGAGGAGAGGAGATTAATTAATAGAGCTGGTGGTAGTTATTGCAATTGTTTTTCTTTAATTAGAGCAAGGTTAATAATATAGACGACATGCTGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.80%	2.50%	5.50%	62.97%	CCCTT: 0.23%
All Indica	2759	12.80%	0.10%	5.55%	81.15%	CCCTT: 0.40%
All Japonica	1512	58.30%	7.30%	6.22%	28.11%	NA
Aus	269	6.70%	0.00%	2.97%	90.33%	NA
Indica I	595	8.90%	0.20%	3.53%	86.89%	CCCTT: 0.50%
Indica II	465	2.60%	0.00%	1.72%	95.48%	CCCTT: 0.22%
Indica III	913	24.20%	0.20%	9.31%	65.72%	CCCTT: 0.55%
Indica Intermediate	786	8.40%	0.10%	4.96%	86.26%	CCCTT: 0.25%
Temperate Japonica	767	63.80%	14.30%	7.95%	13.95%	NA
Tropical Japonica	504	53.80%	0.00%	2.58%	43.65%	NA
Japonica Intermediate	241	50.60%	0.40%	8.30%	40.66%	NA
VI/Aromatic	96	83.30%	0.00%	1.04%	15.62%	NA
Intermediate	90	32.20%	3.30%	4.44%	60.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122418019	C -> CCCTT	LOC_Os11g37850.1	upstream_gene_variant ; 1248.0bp to feature; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> CCCTT	LOC_Os11g37840.1	downstream_gene_variant ; 3785.0bp to feature; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> CCCTT	LOC_Os11g37840-LOC_Os11g37850	intergenic_region ; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> T	LOC_Os11g37850.1	upstream_gene_variant ; 1249.0bp to feature; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> T	LOC_Os11g37840.1	downstream_gene_variant ; 3784.0bp to feature; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> T	LOC_Os11g37840-LOC_Os11g37850	intergenic_region ; MODIFIER	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N
vg1122418019	C -> DEL	N	N	silent_mutation	Average:36.796; most accessible tissue: Callus, score: 84.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122418019	NA	1.34E-13	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122418019	NA	2.06E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	3.62E-08	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	4.73E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	4.97E-06	1.80E-11	mr1354	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	3.66E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	7.64E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	1.97E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	5.07E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	1.00E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	1.55E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	4.12E-06	4.12E-06	mr1181_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	3.91E-09	1.11E-15	mr1354_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	4.56E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	5.05E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122418019	NA	1.28E-09	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251