\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122416969:

Variant ID: vg1122416969 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22416969
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCATTATCTAAAATAAGGGACATATCGATGGCTTCCATCTGTGCTGCATATGTGTTTGCTGCGTAATCAGAAAAAAAATACAATAAAGTCACTCAC[C/A]
TGCACAACTCATCACATAAAAGTCCCTTGATGCAGATAATCGAGTGTTACTTATGTGAGACTCGTTAAGGTGGTGTTTGGATCCAGGGACTTAACTTTAG

Reverse complement sequence

CTAAAGTTAAGTCCCTGGATCCAAACACCACCTTAACGAGTCTCACATAAGTAACACTCGATTATCTGCATCAAGGGACTTTTATGTGATGAGTTGTGCA[G/T]
GTGAGTGACTTTATTGTATTTTTTTTCTGATTACGCAGCAAACACATATGCAGCACAGATGGAAGCCATCGATATGTCCCTTATTTTAGATAATGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 6.50% 0.57% 4.61% NA
All Indica  2759 94.90% 0.30% 0.91% 3.91% NA
All Japonica  1512 75.50% 19.40% 0.13% 5.03% NA
Aus  269 89.20% 0.00% 0.00% 10.78% NA
Indica I  595 95.50% 0.00% 0.17% 4.37% NA
Indica II  465 97.60% 0.40% 0.00% 1.94% NA
Indica III  913 92.60% 0.00% 1.97% 5.48% NA
Indica Intermediate  786 95.70% 0.60% 0.76% 2.93% NA
Temperate Japonica  767 89.00% 6.40% 0.13% 4.43% NA
Tropical Japonica  504 60.10% 32.10% 0.20% 7.54% NA
Japonica Intermediate  241 64.30% 34.00% 0.00% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 8.90% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122416969 C -> A LOC_Os11g37850.1 upstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:38.162; most accessible tissue: Callus, score: 61.828 N N N N
vg1122416969 C -> A LOC_Os11g37840.1 downstream_gene_variant ; 2734.0bp to feature; MODIFIER silent_mutation Average:38.162; most accessible tissue: Callus, score: 61.828 N N N N
vg1122416969 C -> A LOC_Os11g37840-LOC_Os11g37850 intergenic_region ; MODIFIER silent_mutation Average:38.162; most accessible tissue: Callus, score: 61.828 N N N N
vg1122416969 C -> DEL N N silent_mutation Average:38.162; most accessible tissue: Callus, score: 61.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122416969 2.20E-06 2.20E-06 mr1065_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969 NA 4.50E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969 NA 1.97E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969 3.51E-07 1.13E-08 mr1112_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969 NA 3.73E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969 2.77E-06 2.77E-06 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251