\
| Variant ID: vg1122416969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22416969 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTCCATTATCTAAAATAAGGGACATATCGATGGCTTCCATCTGTGCTGCATATGTGTTTGCTGCGTAATCAGAAAAAAAATACAATAAAGTCACTCAC[C/A]
TGCACAACTCATCACATAAAAGTCCCTTGATGCAGATAATCGAGTGTTACTTATGTGAGACTCGTTAAGGTGGTGTTTGGATCCAGGGACTTAACTTTAG
CTAAAGTTAAGTCCCTGGATCCAAACACCACCTTAACGAGTCTCACATAAGTAACACTCGATTATCTGCATCAAGGGACTTTTATGTGATGAGTTGTGCA[G/T]
GTGAGTGACTTTATTGTATTTTTTTTCTGATTACGCAGCAAACACATATGCAGCACAGATGGAAGCCATCGATATGTCCCTTATTTTAGATAATGGAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 6.50% | 0.57% | 4.61% | NA |
| All Indica | 2759 | 94.90% | 0.30% | 0.91% | 3.91% | NA |
| All Japonica | 1512 | 75.50% | 19.40% | 0.13% | 5.03% | NA |
| Aus | 269 | 89.20% | 0.00% | 0.00% | 10.78% | NA |
| Indica I | 595 | 95.50% | 0.00% | 0.17% | 4.37% | NA |
| Indica II | 465 | 97.60% | 0.40% | 0.00% | 1.94% | NA |
| Indica III | 913 | 92.60% | 0.00% | 1.97% | 5.48% | NA |
| Indica Intermediate | 786 | 95.70% | 0.60% | 0.76% | 2.93% | NA |
| Temperate Japonica | 767 | 89.00% | 6.40% | 0.13% | 4.43% | NA |
| Tropical Japonica | 504 | 60.10% | 32.10% | 0.20% | 7.54% | NA |
| Japonica Intermediate | 241 | 64.30% | 34.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 8.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122416969 | C -> A | LOC_Os11g37850.1 | upstream_gene_variant ; 2299.0bp to feature; MODIFIER | silent_mutation | Average:38.162; most accessible tissue: Callus, score: 61.828 | N | N | N | N |
| vg1122416969 | C -> A | LOC_Os11g37840.1 | downstream_gene_variant ; 2734.0bp to feature; MODIFIER | silent_mutation | Average:38.162; most accessible tissue: Callus, score: 61.828 | N | N | N | N |
| vg1122416969 | C -> A | LOC_Os11g37840-LOC_Os11g37850 | intergenic_region ; MODIFIER | silent_mutation | Average:38.162; most accessible tissue: Callus, score: 61.828 | N | N | N | N |
| vg1122416969 | C -> DEL | N | N | silent_mutation | Average:38.162; most accessible tissue: Callus, score: 61.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122416969 | 2.20E-06 | 2.20E-06 | mr1065_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122416969 | NA | 4.50E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122416969 | NA | 1.97E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122416969 | 3.51E-07 | 1.13E-08 | mr1112_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122416969 | NA | 3.73E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122416969 | 2.77E-06 | 2.77E-06 | mr1234_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |