Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122416969:

Variant ID: vg1122416969 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22416969
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTCCATTATCTAAAATAAGGGACATATCGATGGCTTCCATCTGTGCTGCATATGTGTTTGCTGCGTAATCAGAAAAAAAATACAATAAAGTCACTCAC[C/A]
TGCACAACTCATCACATAAAAGTCCCTTGATGCAGATAATCGAGTGTTACTTATGTGAGACTCGTTAAGGTGGTGTTTGGATCCAGGGACTTAACTTTAG

Reverse complement sequence

CTAAAGTTAAGTCCCTGGATCCAAACACCACCTTAACGAGTCTCACATAAGTAACACTCGATTATCTGCATCAAGGGACTTTTATGTGATGAGTTGTGCA[G/T]
GTGAGTGACTTTATTGTATTTTTTTTCTGATTACGCAGCAAACACATATGCAGCACAGATGGAAGCCATCGATATGTCCCTTATTTTAGATAATGGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	6.50%	0.57%	4.61%	NA
All Indica	2759	94.90%	0.30%	0.91%	3.91%	NA
All Japonica	1512	75.50%	19.40%	0.13%	5.03%	NA
Aus	269	89.20%	0.00%	0.00%	10.78%	NA
Indica I	595	95.50%	0.00%	0.17%	4.37%	NA
Indica II	465	97.60%	0.40%	0.00%	1.94%	NA
Indica III	913	92.60%	0.00%	1.97%	5.48%	NA
Indica Intermediate	786	95.70%	0.60%	0.76%	2.93%	NA
Temperate Japonica	767	89.00%	6.40%	0.13%	4.43%	NA
Tropical Japonica	504	60.10%	32.10%	0.20%	7.54%	NA
Japonica Intermediate	241	64.30%	34.00%	0.00%	1.66%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	8.90%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122416969	C -> A	LOC_Os11g37850.1	upstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:38.162; most accessible tissue: Callus, score: 61.828	N	N	N	N
vg1122416969	C -> A	LOC_Os11g37840.1	downstream_gene_variant ; 2734.0bp to feature; MODIFIER	silent_mutation	Average:38.162; most accessible tissue: Callus, score: 61.828	N	N	N	N
vg1122416969	C -> A	LOC_Os11g37840-LOC_Os11g37850	intergenic_region ; MODIFIER	silent_mutation	Average:38.162; most accessible tissue: Callus, score: 61.828	N	N	N	N
vg1122416969	C -> DEL	N	N	silent_mutation	Average:38.162; most accessible tissue: Callus, score: 61.828	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122416969	2.20E-06	2.20E-06	mr1065_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969	NA	4.50E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969	NA	1.97E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969	3.51E-07	1.13E-08	mr1112_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969	NA	3.73E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122416969	2.77E-06	2.77E-06	mr1234_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251