| Variant ID: vg1122414487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22414487 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGATAAGTGGAGTTTCAATAAAAAATAAGATTAGGGACATATCGACGGTGTCCATAACCTTGATATAAAAAATAGCTGCTTATTAAGCAAATAGCTTTTC[C/T]
AGTTGTTTAATGGTGCAGGCCTATGGCAAGACCTTTTGCGAAATAAATACTTAAAGGGTAAACCTCTTTCTGGTATGTCCAGCAAGATAGGTATTTCTCA
TGAGAAATACCTATCTTGCTGGACATACCAGAAAGAGGTTTACCCTTTAAGTATTTATTTCGCAAAAGGTCTTGCCATAGGCCTGCACCATTAAACAACT[G/A]
GAAAAGCTATTTGCTTAATAAGCAGCTATTTTTTATATCAAGGTTATGGACACCGTCGATATGTCCCTAATCTTATTTTTTATTGAAACTCCACTTATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.90% | 11.60% | 3.77% | 55.78% | NA |
| All Indica | 2759 | 4.70% | 15.90% | 3.08% | 76.26% | NA |
| All Japonica | 1512 | 77.40% | 4.90% | 1.39% | 16.27% | NA |
| Aus | 269 | 5.20% | 7.10% | 1.49% | 86.25% | NA |
| Indica I | 595 | 8.10% | 6.20% | 2.18% | 83.53% | NA |
| Indica II | 465 | 2.40% | 1.50% | 2.58% | 93.55% | NA |
| Indica III | 913 | 3.90% | 34.60% | 3.40% | 58.05% | NA |
| Indica Intermediate | 786 | 4.50% | 10.20% | 3.69% | 81.68% | NA |
| Temperate Japonica | 767 | 83.80% | 2.90% | 0.52% | 12.78% | NA |
| Tropical Japonica | 504 | 76.80% | 4.20% | 2.18% | 16.87% | NA |
| Japonica Intermediate | 241 | 58.50% | 12.90% | 2.49% | 26.14% | NA |
| VI/Aromatic | 96 | 19.80% | 8.30% | 59.38% | 12.50% | NA |
| Intermediate | 90 | 35.60% | 5.60% | 12.22% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122414487 | C -> T | LOC_Os11g37850.1 | upstream_gene_variant ; 4781.0bp to feature; MODIFIER | silent_mutation | Average:26.119; most accessible tissue: Callus, score: 62.653 | N | N | N | N |
| vg1122414487 | C -> T | LOC_Os11g37840.1 | downstream_gene_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:26.119; most accessible tissue: Callus, score: 62.653 | N | N | N | N |
| vg1122414487 | C -> T | LOC_Os11g37840-LOC_Os11g37850 | intergenic_region ; MODIFIER | silent_mutation | Average:26.119; most accessible tissue: Callus, score: 62.653 | N | N | N | N |
| vg1122414487 | C -> DEL | N | N | silent_mutation | Average:26.119; most accessible tissue: Callus, score: 62.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122414487 | 1.69E-06 | 1.65E-08 | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122414487 | 2.21E-08 | 4.78E-13 | mr1693 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122414487 | NA | 9.98E-07 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122414487 | NA | 3.48E-08 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122414487 | NA | 1.88E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |