\
| Variant ID: vg1122410899 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22410899 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 45. )
CAAAAATACTCTTTCAACAAGGGACCAATCCCTCCGCATGCATGTGGCCGCTGTGCCGTGGCGTGAGCTTGGCCATCGGCATGCAGATAACACCACTATA[C/T]
GTCCACTGAGGTCTGGACTTTTTGGCTATATACCTATGGACAGAGACAGGGGATGTAACCCATTTTCATTATCTAAAAAAAATATGTCCACTGAGGTCTC
GAGACCTCAGTGGACATATTTTTTTTAGATAATGAAAATGGGTTACATCCCCTGTCTCTGTCCATAGGTATATAGCCAAAAAGTCCAGACCTCAGTGGAC[G/A]
TATAGTGGTGTTATCTGCATGCCGATGGCCAAGCTCACGCCACGGCACAGCGGCCACATGCATGCGGAGGGATTGGTCCCTTGTTGAAAGAGTATTTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 12.80% | 0.59% | 54.02% | NA |
| All Indica | 2759 | 19.20% | 14.00% | 0.83% | 65.97% | NA |
| All Japonica | 1512 | 61.50% | 12.40% | 0.13% | 25.93% | NA |
| Aus | 269 | 18.20% | 0.00% | 0.37% | 81.41% | NA |
| Indica I | 595 | 40.80% | 11.60% | 1.01% | 46.55% | NA |
| Indica II | 465 | 24.50% | 1.70% | 1.08% | 72.69% | NA |
| Indica III | 913 | 1.20% | 26.80% | 0.33% | 71.63% | NA |
| Indica Intermediate | 786 | 20.50% | 8.30% | 1.15% | 70.10% | NA |
| Temperate Japonica | 767 | 76.50% | 12.30% | 0.13% | 11.08% | NA |
| Tropical Japonica | 504 | 52.20% | 5.60% | 0.20% | 42.06% | NA |
| Japonica Intermediate | 241 | 33.20% | 27.40% | 0.00% | 39.42% | NA |
| VI/Aromatic | 96 | 3.10% | 19.80% | 0.00% | 77.08% | NA |
| Intermediate | 90 | 31.10% | 13.30% | 2.22% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122410899 | C -> T | LOC_Os11g37830.1 | upstream_gene_variant ; 4067.0bp to feature; MODIFIER | silent_mutation | Average:15.616; most accessible tissue: Callus, score: 77.326 | N | N | N | N |
| vg1122410899 | C -> T | LOC_Os11g37840.1 | upstream_gene_variant ; 2603.0bp to feature; MODIFIER | silent_mutation | Average:15.616; most accessible tissue: Callus, score: 77.326 | N | N | N | N |
| vg1122410899 | C -> T | LOC_Os11g37830-LOC_Os11g37840 | intergenic_region ; MODIFIER | silent_mutation | Average:15.616; most accessible tissue: Callus, score: 77.326 | N | N | N | N |
| vg1122410899 | C -> DEL | N | N | silent_mutation | Average:15.616; most accessible tissue: Callus, score: 77.326 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122410899 | NA | 1.15E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 1.03E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 5.92E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 3.10E-06 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | 1.70E-06 | 1.70E-06 | mr1545 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | 3.76E-06 | 7.09E-07 | mr1579 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 1.40E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | 9.34E-06 | 9.33E-06 | mr1701 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 1.14E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122410899 | NA | 5.78E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |