\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122410899:

Variant ID: vg1122410899 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22410899
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAAATACTCTTTCAACAAGGGACCAATCCCTCCGCATGCATGTGGCCGCTGTGCCGTGGCGTGAGCTTGGCCATCGGCATGCAGATAACACCACTATA[C/T]
GTCCACTGAGGTCTGGACTTTTTGGCTATATACCTATGGACAGAGACAGGGGATGTAACCCATTTTCATTATCTAAAAAAAATATGTCCACTGAGGTCTC

Reverse complement sequence

GAGACCTCAGTGGACATATTTTTTTTAGATAATGAAAATGGGTTACATCCCCTGTCTCTGTCCATAGGTATATAGCCAAAAAGTCCAGACCTCAGTGGAC[G/A]
TATAGTGGTGTTATCTGCATGCCGATGGCCAAGCTCACGCCACGGCACAGCGGCCACATGCATGCGGAGGGATTGGTCCCTTGTTGAAAGAGTATTTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 12.80% 0.59% 54.02% NA
All Indica  2759 19.20% 14.00% 0.83% 65.97% NA
All Japonica  1512 61.50% 12.40% 0.13% 25.93% NA
Aus  269 18.20% 0.00% 0.37% 81.41% NA
Indica I  595 40.80% 11.60% 1.01% 46.55% NA
Indica II  465 24.50% 1.70% 1.08% 72.69% NA
Indica III  913 1.20% 26.80% 0.33% 71.63% NA
Indica Intermediate  786 20.50% 8.30% 1.15% 70.10% NA
Temperate Japonica  767 76.50% 12.30% 0.13% 11.08% NA
Tropical Japonica  504 52.20% 5.60% 0.20% 42.06% NA
Japonica Intermediate  241 33.20% 27.40% 0.00% 39.42% NA
VI/Aromatic  96 3.10% 19.80% 0.00% 77.08% NA
Intermediate  90 31.10% 13.30% 2.22% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122410899 C -> T LOC_Os11g37830.1 upstream_gene_variant ; 4067.0bp to feature; MODIFIER silent_mutation Average:15.616; most accessible tissue: Callus, score: 77.326 N N N N
vg1122410899 C -> T LOC_Os11g37840.1 upstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:15.616; most accessible tissue: Callus, score: 77.326 N N N N
vg1122410899 C -> T LOC_Os11g37830-LOC_Os11g37840 intergenic_region ; MODIFIER silent_mutation Average:15.616; most accessible tissue: Callus, score: 77.326 N N N N
vg1122410899 C -> DEL N N silent_mutation Average:15.616; most accessible tissue: Callus, score: 77.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122410899 NA 1.15E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 1.03E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 5.92E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 3.10E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 1.70E-06 1.70E-06 mr1545 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 3.76E-06 7.09E-07 mr1579 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 1.40E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 9.34E-06 9.33E-06 mr1701 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 1.14E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899 NA 5.78E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251