Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122409633:

Variant ID: vg1122409633 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22409633
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, T: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CACTGCAAGAGCCATATGTGTTGTGTCATCAGTGATCTCATTTAGTGTTGGTGTTGAATCCTTAGACCTGAGATTATCACGGTTCCCAACATGTGTAGTA[T/G]
CTTACTTAGGGGCTGCTAAACGCTACTCCGTAATTGGGTAGTTATAAAAGTAGTTTTCGGGTATGCTATGAAACATGTAGTGCGATATGAATAATCAAGA

Reverse complement sequence

TCTTGATTATTCATATCGCACTACATGTTTCATAGCATACCCGAAAACTACTTTTATAACTACCCAATTACGGAGTAGCGTTTAGCAGCCCCTAAGTAAG[A/C]
TACTACACATGTTGGGAACCGTGATAATCTCAGGTCTAAGGATTCAACACCAACACTAAATGAGATCACTGATGACACAACACATATGGCTCTTGCAGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	14.60%	0.89%	51.95%	NA
All Indica	2759	19.20%	14.40%	1.34%	64.99%	NA
All Japonica	1512	61.50%	12.60%	0.13%	25.79%	NA
Aus	269	18.20%	0.40%	0.74%	80.67%	NA
Indica I	595	41.30%	11.80%	1.68%	45.21%	NA
Indica II	465	24.70%	1.70%	0.65%	72.90%	NA
Indica III	913	1.20%	27.40%	1.10%	70.32%	NA
Indica Intermediate	786	20.20%	8.90%	1.78%	69.08%	NA
Temperate Japonica	767	76.70%	12.10%	0.00%	11.21%	NA
Tropical Japonica	504	52.20%	5.80%	0.20%	41.87%	NA
Japonica Intermediate	241	32.80%	28.20%	0.41%	38.59%	NA
VI/Aromatic	96	2.10%	81.20%	0.00%	16.67%	NA
Intermediate	90	31.10%	24.40%	1.11%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122409633	T -> DEL	N	N	silent_mutation	Average:9.629; most accessible tissue: Callus, score: 17.5	N	N	N	N
vg1122409633	T -> G	LOC_Os11g37830.1	upstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:9.629; most accessible tissue: Callus, score: 17.5	N	N	N	N
vg1122409633	T -> G	LOC_Os11g37840.1	upstream_gene_variant ; 3869.0bp to feature; MODIFIER	silent_mutation	Average:9.629; most accessible tissue: Callus, score: 17.5	N	N	N	N
vg1122409633	T -> G	LOC_Os11g37830-LOC_Os11g37840	intergenic_region ; MODIFIER	silent_mutation	Average:9.629; most accessible tissue: Callus, score: 17.5	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122409633	NA	6.21E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122409633	6.15E-07	6.14E-07	mr1597	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122409633	NA	1.19E-07	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122409633	NA	4.02E-06	mr1994_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251