\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122377333:

Variant ID: vg1122377333 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22377333
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.06, T: 0.04, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAATTAACGGAATTGCCCCTGCGCAATAAAATAGAAAGACAAATATGCCCTTTTTAATTTTATATTGTAAGTGGTAAGTAAATCAATCTACACCGTTA[T/G]
ATCATTTATATTGGCAGTATATACTGTAGTATATTGTACCGTAAAAGTTCTCTTATAAAATGGGAAACCCGACTACTTCGGTGTCAGAGATTGATGAGGT

Reverse complement sequence

ACCTCATCAATCTCTGACACCGAAGTAGTCGGGTTTCCCATTTTATAAGAGAACTTTTACGGTACAATATACTACAGTATATACTGCCAATATAAATGAT[A/C]
TAACGGTGTAGATTGATTTACTTACCACTTACAATATAAAATTAAAAAGGGCATATTTGTCTTTCTATTTTATTGCGCAGGGGCAATTCCGTTAATTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.60% 11.70% 0.23% 62.48% NA
All Indica  2759 16.70% 1.90% 0.18% 81.19% NA
All Japonica  1512 44.80% 26.40% 0.26% 28.57% NA
Aus  269 16.40% 3.70% 0.37% 79.55% NA
Indica I  595 35.50% 0.20% 0.17% 64.20% NA
Indica II  465 20.40% 0.40% 0.22% 78.92% NA
Indica III  913 1.00% 4.20% 0.33% 94.52% NA
Indica Intermediate  786 18.70% 1.40% 0.00% 79.90% NA
Temperate Japonica  767 70.50% 14.20% 0.26% 14.99% NA
Tropical Japonica  504 16.70% 40.90% 0.20% 42.26% NA
Japonica Intermediate  241 21.60% 34.90% 0.41% 43.15% NA
VI/Aromatic  96 2.10% 77.10% 0.00% 20.83% NA
Intermediate  90 27.80% 18.90% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122377333 T -> DEL N N silent_mutation Average:11.042; most accessible tissue: Callus, score: 57.216 N N N N
vg1122377333 T -> G LOC_Os11g37780-LOC_Os11g37790 intergenic_region ; MODIFIER silent_mutation Average:11.042; most accessible tissue: Callus, score: 57.216 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122377333 NA 2.18E-14 mr1070 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 7.96E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 2.23E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 3.26E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 9.37E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 4.52E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 3.89E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.34E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 4.90E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 9.62E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 4.05E-08 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 4.43E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 2.92E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 2.03E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.91E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.44E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.53E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.82E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.72E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 7.19E-06 7.17E-06 mr1597 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 9.55E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 7.25E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 8.86E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 6.74E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.32E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.24E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 7.93E-09 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 7.93E-09 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 8.11E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 7.17E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 2.14E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122377333 NA 1.72E-07 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251