Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122375960:

Variant ID: vg1122375960 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22375960
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCATTTCCATTGGAAATGGGGAGAAAATAAAATTCTTGACAGATAATTGGTTGCAGGGGAGCTCTCCCAAAGAAATAACGCCTTCAATCTTCCGACTAG[T/C]
GAAGAGGAAATCAAACTGTCTAAAATGGGATTTTGAGAGCAATCACTGGATGGCATGGAAGTGTCTAAAAGAACTTTTACGGTACAATATACTAACAATA

Reverse complement sequence

TATTGTTAGTATATTGTACCGTAAAAGTTCTTTTAGACACTTCCATGCCATCCAGTGATTGCTCTCAAAATCCCATTTTAGACAGTTTGATTTCCTCTTC[A/G]
CTAGTCGGAAGATTGAAGGCGTTATTTCTTTGGGAGAGCTCCCCTGCAACCAATTATCTGTCAAGAATTTTATTTTCTCCCCATTTCCAATGGAAATGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	24.70%	2.03%	7.43%	NA
All Indica	2759	79.20%	16.20%	1.85%	2.72%	NA
All Japonica	1512	36.20%	43.40%	2.58%	17.79%	NA
Aus	269	82.50%	15.60%	1.86%	0.00%	NA
Indica I	595	57.00%	35.00%	4.37%	3.70%	NA
Indica II	465	76.30%	19.60%	2.80%	1.29%	NA
Indica III	913	96.10%	0.90%	0.44%	2.63%	NA
Indica Intermediate	786	78.20%	17.80%	1.02%	2.93%	NA
Temperate Japonica	767	21.90%	69.40%	2.22%	6.52%	NA
Tropical Japonica	504	50.80%	15.10%	2.58%	31.55%	NA
Japonica Intermediate	241	51.50%	19.90%	3.73%	24.90%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	24.40%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122375960	T -> DEL	N	N	silent_mutation	Average:24.047; most accessible tissue: Callus, score: 66.8	N	N	N	N
vg1122375960	T -> C	LOC_Os11g37780-LOC_Os11g37790	intergenic_region ; MODIFIER	silent_mutation	Average:24.047; most accessible tissue: Callus, score: 66.8	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122375960	NA	5.06E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	1.12E-06	1.12E-06	mr1060	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	2.70E-06	mr1126	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	4.97E-06	mr1147	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	5.07E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	8.06E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	5.41E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	8.10E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	2.78E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	3.52E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	2.99E-07	2.99E-07	mr1520	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	1.30E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	1.95E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	1.79E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	2.48E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	4.61E-06	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	4.99E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	9.77E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	1.95E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	7.95E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	4.75E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	2.21E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	2.82E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	1.19E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	3.04E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	9.98E-07	9.99E-07	mr1996	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122375960	NA	7.25E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251