| Variant ID: vg1122373560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22373560 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGTTGAACACACCAAACAAGAGAAGAGAGGACCCAAACTGAAAAAAGCAAAACAAAATGTGGAGCTAGAAGGCCTCGTCAAAGCCTAGGATTGAAGTTC[G/A]
AAGCCAATGCAAAGACCAATGACAATATCCTTGCACGAAGAGATTTCTCCAAAGCGGTGCCCTCAAGGAGGATGTGACGTGGATCGCCGCCACCGCTCGT
ACGAGCGGTGGCGGCGATCCACGTCACATCCTCCTTGAGGGCACCGCTTTGGAGAAATCTCTTCGTGCAAGGATATTGTCATTGGTCTTTGCATTGGCTT[C/T]
GAACTTCAATCCTAGGCTTTGACGAGGCCTTCTAGCTCCACATTTTGTTTTGCTTTTTTCAGTTTGGGTCCTCTCTTCTCTTGTTTGGTGTGTTCAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.70% | 0.30% | 1.23% | 56.83% | NA |
| All Indica | 2759 | 22.80% | 0.10% | 1.92% | 75.21% | NA |
| All Japonica | 1512 | 77.20% | 0.10% | 0.00% | 22.75% | NA |
| Aus | 269 | 19.30% | 1.50% | 1.12% | 78.07% | NA |
| Indica I | 595 | 43.20% | 0.20% | 0.67% | 55.97% | NA |
| Indica II | 465 | 24.90% | 0.20% | 2.15% | 72.69% | NA |
| Indica III | 913 | 6.90% | 0.00% | 2.85% | 90.25% | NA |
| Indica Intermediate | 786 | 24.40% | 0.10% | 1.65% | 73.79% | NA |
| Temperate Japonica | 767 | 85.70% | 0.00% | 0.00% | 14.34% | NA |
| Tropical Japonica | 504 | 68.50% | 0.00% | 0.00% | 31.55% | NA |
| Japonica Intermediate | 241 | 68.50% | 0.40% | 0.00% | 31.12% | NA |
| VI/Aromatic | 96 | 75.00% | 5.20% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 55.60% | 0.00% | 2.22% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122373560 | G -> A | LOC_Os11g37780.1 | downstream_gene_variant ; 2868.0bp to feature; MODIFIER | silent_mutation | Average:11.097; most accessible tissue: Callus, score: 41.06 | N | N | N | N |
| vg1122373560 | G -> A | LOC_Os11g37780-LOC_Os11g37790 | intergenic_region ; MODIFIER | silent_mutation | Average:11.097; most accessible tissue: Callus, score: 41.06 | N | N | N | N |
| vg1122373560 | G -> DEL | N | N | silent_mutation | Average:11.097; most accessible tissue: Callus, score: 41.06 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122373560 | 2.80E-07 | 4.09E-09 | mr1517 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373560 | 3.28E-06 | 1.54E-08 | mr1538 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373560 | NA | 1.32E-06 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373560 | NA | 1.09E-08 | mr1538_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |