\
| Variant ID: vg1122373396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22373396 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 63. )
CTTCACTCAAATAATAAAATCAGACCTTGCACAGGCACTTTCACACTTTGGTGAGCTAAACTCAGATTTTTAGATAATGGAATATAATATCCCGGCCTTT[A/G]
CTCAAAAAGAACTACAGCCAATTATTACAAAGATCCACTCCAGAAGAGAGTGTAGTTCAAGACAAGTTGAACACACCAAACAAGAGAAGAGAGGACCCAA
TTGGGTCCTCTCTTCTCTTGTTTGGTGTGTTCAACTTGTCTTGAACTACACTCTCTTCTGGAGTGGATCTTTGTAATAATTGGCTGTAGTTCTTTTTGAG[T/C]
AAAGGCCGGGATATTATATTCCATTATCTAAAAATCTGAGTTTAGCTCACCAAAGTGTGAAAGTGCCTGTGCAAGGTCTGATTTTATTATTTGAGTGAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.50% | 14.00% | 1.69% | 55.80% | NA |
| All Indica | 2759 | 19.60% | 4.20% | 2.07% | 74.12% | NA |
| All Japonica | 1512 | 47.90% | 29.10% | 0.53% | 22.42% | NA |
| Aus | 269 | 19.00% | 4.10% | 3.35% | 73.61% | NA |
| Indica I | 595 | 37.10% | 5.90% | 1.01% | 55.97% | NA |
| Indica II | 465 | 22.40% | 1.70% | 2.37% | 73.55% | NA |
| Indica III | 913 | 3.80% | 5.00% | 2.85% | 88.28% | NA |
| Indica Intermediate | 786 | 22.90% | 3.60% | 1.78% | 71.76% | NA |
| Temperate Japonica | 767 | 71.20% | 14.20% | 0.65% | 13.95% | NA |
| Tropical Japonica | 504 | 19.80% | 48.60% | 0.40% | 31.15% | NA |
| Japonica Intermediate | 241 | 32.80% | 35.70% | 0.41% | 31.12% | NA |
| VI/Aromatic | 96 | 3.10% | 77.10% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 28.90% | 24.40% | 4.44% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122373396 | A -> DEL | N | N | silent_mutation | Average:14.906; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1122373396 | A -> G | LOC_Os11g37780.1 | downstream_gene_variant ; 2704.0bp to feature; MODIFIER | silent_mutation | Average:14.906; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1122373396 | A -> G | LOC_Os11g37780-LOC_Os11g37790 | intergenic_region ; MODIFIER | silent_mutation | Average:14.906; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122373396 | NA | 4.79E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | 2.92E-07 | 2.92E-07 | mr1060 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 8.95E-06 | mr1126 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 4.12E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 9.05E-06 | mr1287 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 2.87E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 8.35E-07 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 2.05E-06 | mr1614 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 1.48E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 7.20E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 7.15E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 5.59E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | 4.72E-06 | 4.71E-06 | mr1797 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | 4.72E-06 | 4.71E-06 | mr1801 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | NA | 3.51E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122373396 | 3.54E-06 | 3.54E-06 | mr1992 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |