\
| Variant ID: vg1122364508 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22364508 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTAAGTGTCTTTTAAATGCTGTTTACTGCAAAACCTAACCCCTATACTATAACACCATTGTACTCCTTTGCATTTATGTTGCACTTGTGGGTGTGTCTTG[T/G]
TTAGTACGGTGGTTGTACTCAGTCTTGCTCAATTTTTCCCAAACCCAGAAGAGGAGCTCCTGGATGATGAAGGCTTTGGTGTTTAGCTCATGCCTGCCGT
ACGGCAGGCATGAGCTAAACACCAAAGCCTTCATCATCCAGGAGCTCCTCTTCTGGGTTTGGGAAAAATTGAGCAAGACTGAGTACAACCACCGTACTAA[A/C]
CAAGACACACCCACAAGTGCAACATAAATGCAAAGGAGTACAATGGTGTTATAGTATAGGGGTTAGGTTTTGCAGTAAACAGCATTTAAAAGACACTTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 9.40% | 1.44% | 45.60% | NA |
| All Indica | 2759 | 39.10% | 0.40% | 2.21% | 58.21% | NA |
| All Japonica | 1512 | 51.30% | 26.70% | 0.20% | 21.89% | NA |
| Aus | 269 | 28.30% | 7.80% | 1.49% | 62.45% | NA |
| Indica I | 595 | 46.90% | 0.00% | 1.01% | 52.10% | NA |
| Indica II | 465 | 24.70% | 0.20% | 4.30% | 70.75% | NA |
| Indica III | 913 | 46.30% | 0.20% | 1.20% | 52.25% | NA |
| Indica Intermediate | 786 | 33.50% | 1.10% | 3.05% | 62.34% | NA |
| Temperate Japonica | 767 | 75.20% | 13.80% | 0.26% | 10.69% | NA |
| Tropical Japonica | 504 | 21.20% | 42.90% | 0.00% | 35.91% | NA |
| Japonica Intermediate | 241 | 37.80% | 33.60% | 0.41% | 28.22% | NA |
| VI/Aromatic | 96 | 84.40% | 2.10% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 51.10% | 7.80% | 0.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122364508 | T -> DEL | N | N | silent_mutation | Average:9.695; most accessible tissue: Callus, score: 31.452 | N | N | N | N |
| vg1122364508 | T -> G | LOC_Os11g37780.1 | upstream_gene_variant ; 2470.0bp to feature; MODIFIER | silent_mutation | Average:9.695; most accessible tissue: Callus, score: 31.452 | N | N | N | N |
| vg1122364508 | T -> G | LOC_Os11g37774-LOC_Os11g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:9.695; most accessible tissue: Callus, score: 31.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122364508 | NA | 8.34E-06 | mr1148 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 1.29E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 1.15E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 9.60E-07 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | 5.02E-06 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 6.77E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 8.86E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 8.86E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | 2.18E-06 | NA | mr1917 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 1.69E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122364508 | NA | 1.93E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |