\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122356822:

Variant ID: vg1122356822 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22356822
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.29, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACATCATACTGCTGCTTGCTGCCTGACCAAGTGCCCAGGGATGAGAACTCACTCCTGGCCATGATCTGATCCTCTGAGTAGTAAACTGATGCTTAGA[G/A]
CAAGTACAATAGTAGGCTATAAGCTAGCTACAAATATATTTTAATAAGATAATAGAGGAGAGAGAAGAGCAACGGGCTACATATCTGTAGCCAGCTGCAA

Reverse complement sequence

TTGCAGCTGGCTACAGATATGTAGCCCGTTGCTCTTCTCTCTCCTCTATTATCTTATTAAAATATATTTGTAGCTAGCTTATAGCCTACTATTGTACTTG[C/T]
TCTAAGCATCAGTTTACTACTCAGAGGATCAGATCATGGCCAGGAGTGAGTTCTCATCCCTGGGCACTTGGTCAGGCAGCAAGCAGCAGTATGATGTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.30% 15.30% 0.83% 54.59% NA
All Indica  2759 20.20% 7.40% 0.87% 71.51% NA
All Japonica  1512 46.60% 30.00% 0.40% 23.02% NA
Aus  269 4.10% 19.00% 1.49% 75.46% NA
Indica I  595 16.10% 5.70% 0.67% 77.48% NA
Indica II  465 6.70% 2.20% 1.08% 90.11% NA
Indica III  913 34.80% 11.70% 0.44% 53.01% NA
Indica Intermediate  786 14.40% 6.70% 1.40% 77.48% NA
Temperate Japonica  767 72.20% 15.80% 0.00% 11.99% NA
Tropical Japonica  504 15.50% 50.00% 0.99% 33.53% NA
Japonica Intermediate  241 30.30% 33.20% 0.41% 36.10% NA
VI/Aromatic  96 82.30% 3.10% 0.00% 14.58% NA
Intermediate  90 36.70% 11.10% 5.56% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122356822 G -> A LOC_Os11g37774.1 downstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:12.888; most accessible tissue: Callus, score: 80.48 N N N N
vg1122356822 G -> A LOC_Os11g37774-LOC_Os11g37780 intergenic_region ; MODIFIER silent_mutation Average:12.888; most accessible tissue: Callus, score: 80.48 N N N N
vg1122356822 G -> DEL N N silent_mutation Average:12.888; most accessible tissue: Callus, score: 80.48 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122356822 NA 6.49E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 1.69E-06 1.69E-06 mr1060 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 7.65E-06 mr1148 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.44E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 9.49E-06 mr1287 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.40E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 9.31E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 4.34E-06 4.34E-06 mr1418 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 2.74E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.51E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 7.16E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.98E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.11E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 8.59E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 5.94E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 NA 1.06E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 6.47E-06 6.46E-06 mr1797 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 6.47E-06 6.46E-06 mr1801 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122356822 2.80E-06 2.80E-06 mr1992 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251