\
| Variant ID: vg1122356822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22356822 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.29, others allele: 0.00, population size: 68. )
AGCACATCATACTGCTGCTTGCTGCCTGACCAAGTGCCCAGGGATGAGAACTCACTCCTGGCCATGATCTGATCCTCTGAGTAGTAAACTGATGCTTAGA[G/A]
CAAGTACAATAGTAGGCTATAAGCTAGCTACAAATATATTTTAATAAGATAATAGAGGAGAGAGAAGAGCAACGGGCTACATATCTGTAGCCAGCTGCAA
TTGCAGCTGGCTACAGATATGTAGCCCGTTGCTCTTCTCTCTCCTCTATTATCTTATTAAAATATATTTGTAGCTAGCTTATAGCCTACTATTGTACTTG[C/T]
TCTAAGCATCAGTTTACTACTCAGAGGATCAGATCATGGCCAGGAGTGAGTTCTCATCCCTGGGCACTTGGTCAGGCAGCAAGCAGCAGTATGATGTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.30% | 15.30% | 0.83% | 54.59% | NA |
| All Indica | 2759 | 20.20% | 7.40% | 0.87% | 71.51% | NA |
| All Japonica | 1512 | 46.60% | 30.00% | 0.40% | 23.02% | NA |
| Aus | 269 | 4.10% | 19.00% | 1.49% | 75.46% | NA |
| Indica I | 595 | 16.10% | 5.70% | 0.67% | 77.48% | NA |
| Indica II | 465 | 6.70% | 2.20% | 1.08% | 90.11% | NA |
| Indica III | 913 | 34.80% | 11.70% | 0.44% | 53.01% | NA |
| Indica Intermediate | 786 | 14.40% | 6.70% | 1.40% | 77.48% | NA |
| Temperate Japonica | 767 | 72.20% | 15.80% | 0.00% | 11.99% | NA |
| Tropical Japonica | 504 | 15.50% | 50.00% | 0.99% | 33.53% | NA |
| Japonica Intermediate | 241 | 30.30% | 33.20% | 0.41% | 36.10% | NA |
| VI/Aromatic | 96 | 82.30% | 3.10% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 36.70% | 11.10% | 5.56% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122356822 | G -> A | LOC_Os11g37774.1 | downstream_gene_variant ; 424.0bp to feature; MODIFIER | silent_mutation | Average:12.888; most accessible tissue: Callus, score: 80.48 | N | N | N | N |
| vg1122356822 | G -> A | LOC_Os11g37774-LOC_Os11g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:12.888; most accessible tissue: Callus, score: 80.48 | N | N | N | N |
| vg1122356822 | G -> DEL | N | N | silent_mutation | Average:12.888; most accessible tissue: Callus, score: 80.48 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122356822 | NA | 6.49E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | 1.69E-06 | 1.69E-06 | mr1060 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 7.65E-06 | mr1148 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.44E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 9.49E-06 | mr1287 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.40E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 9.31E-07 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | 4.34E-06 | 4.34E-06 | mr1418 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 2.74E-06 | mr1492 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.51E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 7.16E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.98E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.11E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 8.59E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 5.94E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | NA | 1.06E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | 6.47E-06 | 6.46E-06 | mr1797 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | 6.47E-06 | 6.46E-06 | mr1801 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122356822 | 2.80E-06 | 2.80E-06 | mr1992 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |