\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122341383:

Variant ID: vg1122341383 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22341383
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.05, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCAGGGATTCTAAGTCCGATCCCCCCTCCTCGCTAGGCATGATCCTCCTTTTATACTCTAAGGGGATACCACATGTGCTAGAGTGCTACCTAGGGAGA[G/A]
GGGAAAATATTCTCTATATTAATTGCATGTCTTGTGCCTTAGCCCAGAAGCTATCTGCACGTCGGTTGCTGCACGGGGCCACTCAAATCATGCAGGGCGC

Reverse complement sequence

GCGCCCTGCATGATTTGAGTGGCCCCGTGCAGCAACCGACGTGCAGATAGCTTCTGGGCTAAGGCACAAGACATGCAATTAATATAGAGAATATTTTCCC[C/T]
TCTCCCTAGGTAGCACTCTAGCACATGTGGTATCCCCTTAGAGTATAAAAGGAGGATCATGCCTAGCGAGGAGGGGGGATCGGACTTAGAATCCCTGAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.80% 16.70% 0.47% 65.00% NA
All Indica  2759 9.10% 4.20% 0.33% 86.41% NA
All Japonica  1512 30.20% 41.40% 0.60% 27.78% NA
Aus  269 20.10% 5.20% 0.37% 74.35% NA
Indica I  595 5.70% 6.70% 0.17% 87.39% NA
Indica II  465 2.20% 5.80% 0.65% 91.40% NA
Indica III  913 16.30% 0.80% 0.00% 82.91% NA
Indica Intermediate  786 7.40% 5.20% 0.64% 86.77% NA
Temperate Japonica  767 16.30% 68.80% 0.39% 14.47% NA
Tropical Japonica  504 50.40% 10.90% 0.99% 37.70% NA
Japonica Intermediate  241 32.40% 17.80% 0.41% 49.38% NA
VI/Aromatic  96 59.40% 21.90% 0.00% 18.75% NA
Intermediate  90 24.40% 16.70% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122341383 G -> A LOC_Os11g37770.1 upstream_gene_variant ; 666.0bp to feature; MODIFIER silent_mutation Average:8.189; most accessible tissue: Callus, score: 27.667 N N N N
vg1122341383 G -> A LOC_Os11g37770-LOC_Os11g37774 intergenic_region ; MODIFIER silent_mutation Average:8.189; most accessible tissue: Callus, score: 27.667 N N N N
vg1122341383 G -> DEL N N silent_mutation Average:8.189; most accessible tissue: Callus, score: 27.667 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122341383 NA 4.81E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.81E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 9.22E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 3.02E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.16E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 1.52E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 9.22E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 4.81E-07 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 5.58E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 6.04E-06 mr1561 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 9.34E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 3.74E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 5.94E-06 mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 7.53E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 1.42E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 3.50E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 1.33E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 1.25E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.61E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.47E-06 mr1837 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 3.25E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 8.43E-07 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.60E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 6.10E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 2.07E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 3.30E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383 NA 1.10E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251