Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122341383:

Variant ID: vg1122341383 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22341383
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.05, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCAGGGATTCTAAGTCCGATCCCCCCTCCTCGCTAGGCATGATCCTCCTTTTATACTCTAAGGGGATACCACATGTGCTAGAGTGCTACCTAGGGAGA[G/A]
GGGAAAATATTCTCTATATTAATTGCATGTCTTGTGCCTTAGCCCAGAAGCTATCTGCACGTCGGTTGCTGCACGGGGCCACTCAAATCATGCAGGGCGC

Reverse complement sequence

GCGCCCTGCATGATTTGAGTGGCCCCGTGCAGCAACCGACGTGCAGATAGCTTCTGGGCTAAGGCACAAGACATGCAATTAATATAGAGAATATTTTCCC[C/T]
TCTCCCTAGGTAGCACTCTAGCACATGTGGTATCCCCTTAGAGTATAAAAGGAGGATCATGCCTAGCGAGGAGGGGGGATCGGACTTAGAATCCCTGAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.80%	16.70%	0.47%	65.00%	NA
All Indica	2759	9.10%	4.20%	0.33%	86.41%	NA
All Japonica	1512	30.20%	41.40%	0.60%	27.78%	NA
Aus	269	20.10%	5.20%	0.37%	74.35%	NA
Indica I	595	5.70%	6.70%	0.17%	87.39%	NA
Indica II	465	2.20%	5.80%	0.65%	91.40%	NA
Indica III	913	16.30%	0.80%	0.00%	82.91%	NA
Indica Intermediate	786	7.40%	5.20%	0.64%	86.77%	NA
Temperate Japonica	767	16.30%	68.80%	0.39%	14.47%	NA
Tropical Japonica	504	50.40%	10.90%	0.99%	37.70%	NA
Japonica Intermediate	241	32.40%	17.80%	0.41%	49.38%	NA
VI/Aromatic	96	59.40%	21.90%	0.00%	18.75%	NA
Intermediate	90	24.40%	16.70%	3.33%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122341383	G -> A	LOC_Os11g37770.1	upstream_gene_variant ; 666.0bp to feature; MODIFIER	silent_mutation	Average:8.189; most accessible tissue: Callus, score: 27.667	N	N	N	N
vg1122341383	G -> A	LOC_Os11g37770-LOC_Os11g37774	intergenic_region ; MODIFIER	silent_mutation	Average:8.189; most accessible tissue: Callus, score: 27.667	N	N	N	N
vg1122341383	G -> DEL	N	N	silent_mutation	Average:8.189; most accessible tissue: Callus, score: 27.667	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122341383	NA	4.81E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.81E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	9.22E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	3.02E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.16E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	1.52E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	9.22E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	4.81E-07	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	5.58E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	6.04E-06	mr1561	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	9.34E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	3.74E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	5.94E-06	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	7.53E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	1.42E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	3.50E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	1.33E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	1.25E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.61E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.47E-06	mr1837	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	3.25E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	8.43E-07	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.60E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	6.10E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	2.07E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	3.30E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122341383	NA	1.10E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251