\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122336896:

Variant ID: vg1122336896 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22336896
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAAAAAATTCATCTTTCTCGTCATATCAACTCGCACCATCCTGAGTGACTCATCCATGTTCCTGATGCCTTCACCAAACTAATTTAATTAACCAGAG[T/C]
AAGCTGAGAATCAAGCTCTCCCCACCATATGATCACTTTCCCTGAAGACCTGCAACCTCACGCTAGCTGATCCAGCTGCTAGCCATGGAGACGCCTCCGA

Reverse complement sequence

TCGGAGGCGTCTCCATGGCTAGCAGCTGGATCAGCTAGCGTGAGGTTGCAGGTCTTCAGGGAAAGTGATCATATGGTGGGGAGAGCTTGATTCTCAGCTT[A/G]
CTCTGGTTAATTAAATTAGTTTGGTGAAGGCATCAGGAACATGGATGAGTCACTCAGGATGGTGCGAGTTGATATGACGAGAAAGATGAATTTTTTTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.50% 16.80% 0.34% 65.28% NA
All Indica  2759 10.00% 4.30% 0.40% 85.28% NA
All Japonica  1512 30.90% 41.50% 0.20% 27.38% NA
Aus  269 19.30% 4.80% 0.37% 75.46% NA
Indica I  595 10.80% 6.70% 0.84% 81.68% NA
Indica II  465 2.20% 5.80% 0.86% 91.18% NA
Indica III  913 15.80% 0.80% 0.11% 83.35% NA
Indica Intermediate  786 7.40% 5.70% 0.13% 86.77% NA
Temperate Japonica  767 17.20% 69.10% 0.13% 13.56% NA
Tropical Japonica  504 51.00% 10.90% 0.40% 37.70% NA
Japonica Intermediate  241 32.40% 17.80% 0.00% 49.79% NA
VI/Aromatic  96 16.70% 21.90% 0.00% 61.46% NA
Intermediate  90 20.00% 16.70% 1.11% 62.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122336896 T -> DEL N N silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N
vg1122336896 T -> C LOC_Os11g37759.1 downstream_gene_variant ; 2818.0bp to feature; MODIFIER silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N
vg1122336896 T -> C LOC_Os11g37770.1 downstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N
vg1122336896 T -> C LOC_Os11g37759.3 downstream_gene_variant ; 2832.0bp to feature; MODIFIER silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N
vg1122336896 T -> C LOC_Os11g37759.2 downstream_gene_variant ; 2815.0bp to feature; MODIFIER silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N
vg1122336896 T -> C LOC_Os11g37759-LOC_Os11g37770 intergenic_region ; MODIFIER silent_mutation Average:13.17; most accessible tissue: Callus, score: 80.33 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122336896 NA 9.95E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 4.76E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 9.48E-06 9.48E-06 mr1060 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.22E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.63E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.60E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 2.86E-06 NA mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.86E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 4.72E-07 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.50E-06 mr1456 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.01E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.75E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 4.66E-06 mr1561 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 6.35E-08 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.74E-06 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 3.59E-06 mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.36E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 2.51E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.22E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 1.83E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 4.92E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896 NA 6.35E-07 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251