Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122336896:

Variant ID: vg1122336896 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22336896
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

ACGAAAAAAATTCATCTTTCTCGTCATATCAACTCGCACCATCCTGAGTGACTCATCCATGTTCCTGATGCCTTCACCAAACTAATTTAATTAACCAGAG[T/C]
AAGCTGAGAATCAAGCTCTCCCCACCATATGATCACTTTCCCTGAAGACCTGCAACCTCACGCTAGCTGATCCAGCTGCTAGCCATGGAGACGCCTCCGA

Reverse complement sequence

TCGGAGGCGTCTCCATGGCTAGCAGCTGGATCAGCTAGCGTGAGGTTGCAGGTCTTCAGGGAAAGTGATCATATGGTGGGGAGAGCTTGATTCTCAGCTT[A/G]
CTCTGGTTAATTAAATTAGTTTGGTGAAGGCATCAGGAACATGGATGAGTCACTCAGGATGGTGCGAGTTGATATGACGAGAAAGATGAATTTTTTTCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.50%	16.80%	0.34%	65.28%	NA
All Indica	2759	10.00%	4.30%	0.40%	85.28%	NA
All Japonica	1512	30.90%	41.50%	0.20%	27.38%	NA
Aus	269	19.30%	4.80%	0.37%	75.46%	NA
Indica I	595	10.80%	6.70%	0.84%	81.68%	NA
Indica II	465	2.20%	5.80%	0.86%	91.18%	NA
Indica III	913	15.80%	0.80%	0.11%	83.35%	NA
Indica Intermediate	786	7.40%	5.70%	0.13%	86.77%	NA
Temperate Japonica	767	17.20%	69.10%	0.13%	13.56%	NA
Tropical Japonica	504	51.00%	10.90%	0.40%	37.70%	NA
Japonica Intermediate	241	32.40%	17.80%	0.00%	49.79%	NA
VI/Aromatic	96	16.70%	21.90%	0.00%	61.46%	NA
Intermediate	90	20.00%	16.70%	1.11%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122336896	T -> DEL	N	N	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N
vg1122336896	T -> C	LOC_Os11g37759.1	downstream_gene_variant ; 2818.0bp to feature; MODIFIER	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N
vg1122336896	T -> C	LOC_Os11g37770.1	downstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N
vg1122336896	T -> C	LOC_Os11g37759.3	downstream_gene_variant ; 2832.0bp to feature; MODIFIER	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N
vg1122336896	T -> C	LOC_Os11g37759.2	downstream_gene_variant ; 2815.0bp to feature; MODIFIER	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N
vg1122336896	T -> C	LOC_Os11g37759-LOC_Os11g37770	intergenic_region ; MODIFIER	silent_mutation	Average:13.17; most accessible tissue: Callus, score: 80.33	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122336896	NA	9.95E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	4.76E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	9.48E-06	9.48E-06	mr1060	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.22E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.63E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.60E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	2.86E-06	NA	mr1338	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.86E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	4.72E-07	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.50E-06	mr1456	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.01E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.75E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	4.66E-06	mr1561	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	6.35E-08	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.74E-06	mr1579	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	3.59E-06	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.36E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	2.51E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.22E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	1.83E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	4.92E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122336896	NA	6.35E-07	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251