\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122327568:

Variant ID: vg1122327568 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22327568
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCATAATTTTTTATTTTTCTAATTTATTAAAATGCCAAGTAGCGGTGTAGGAGCGTTTGTAGAAGTATTAAATGGCGGCTTGAGAGCGTTTATAGGAT[A/G]
TTTAATGGACAAAGAGCTAAATATGCTTCCATATGATAATTTTTAAATTGAAATATAGTTAATATCAAATGTAGTCATAATATTATCACTATACACATCT

Reverse complement sequence

AGATGTGTATAGTGATAATATTATGACTACATTTGATATTAACTATATTTCAATTTAAAAATTATCATATGGAAGCATATTTAGCTCTTTGTCCATTAAA[T/C]
ATCCTATAAACGCTCTCAAGCCGCCATTTAATACTTCTACAAACGCTCCTACACCGCTACTTGGCATTTTAATAAATTAGAAAAATAAAAAATTATGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 5.60% 13.18% 15.30% NA
All Indica  2759 49.10% 9.50% 21.86% 19.54% NA
All Japonica  1512 89.10% 0.10% 0.66% 10.12% NA
Aus  269 98.10% 0.00% 0.00% 1.86% NA
Indica I  595 43.50% 3.90% 10.25% 42.35% NA
Indica II  465 32.50% 20.00% 36.13% 11.40% NA
Indica III  913 65.10% 8.30% 19.82% 6.79% NA
Indica Intermediate  786 44.80% 8.80% 24.55% 21.88% NA
Temperate Japonica  767 93.00% 0.10% 0.13% 6.78% NA
Tropical Japonica  504 82.90% 0.20% 0.79% 16.07% NA
Japonica Intermediate  241 89.60% 0.00% 2.07% 8.30% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 60.00% 4.40% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122327568 A -> DEL N N silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N
vg1122327568 A -> G LOC_Os11g37759.1 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N
vg1122327568 A -> G LOC_Os11g37759.3 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N
vg1122327568 A -> G LOC_Os11g37759.2 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N
vg1122327568 A -> G LOC_Os11g37750.1 downstream_gene_variant ; 2579.0bp to feature; MODIFIER silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N
vg1122327568 A -> G LOC_Os11g37750-LOC_Os11g37759 intergenic_region ; MODIFIER silent_mutation Average:18.32; most accessible tissue: Callus, score: 57.983 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122327568 NA 3.27E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122327568 4.31E-06 3.10E-07 mr1319 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122327568 2.60E-06 5.12E-07 mr1319 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122327568 3.89E-06 NA mr1531 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122327568 NA 7.02E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251