\
| Variant ID: vg1122327568 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22327568 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTCATAATTTTTTATTTTTCTAATTTATTAAAATGCCAAGTAGCGGTGTAGGAGCGTTTGTAGAAGTATTAAATGGCGGCTTGAGAGCGTTTATAGGAT[A/G]
TTTAATGGACAAAGAGCTAAATATGCTTCCATATGATAATTTTTAAATTGAAATATAGTTAATATCAAATGTAGTCATAATATTATCACTATACACATCT
AGATGTGTATAGTGATAATATTATGACTACATTTGATATTAACTATATTTCAATTTAAAAATTATCATATGGAAGCATATTTAGCTCTTTGTCCATTAAA[T/C]
ATCCTATAAACGCTCTCAAGCCGCCATTTAATACTTCTACAAACGCTCCTACACCGCTACTTGGCATTTTAATAAATTAGAAAAATAAAAAATTATGAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 5.60% | 13.18% | 15.30% | NA |
| All Indica | 2759 | 49.10% | 9.50% | 21.86% | 19.54% | NA |
| All Japonica | 1512 | 89.10% | 0.10% | 0.66% | 10.12% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 43.50% | 3.90% | 10.25% | 42.35% | NA |
| Indica II | 465 | 32.50% | 20.00% | 36.13% | 11.40% | NA |
| Indica III | 913 | 65.10% | 8.30% | 19.82% | 6.79% | NA |
| Indica Intermediate | 786 | 44.80% | 8.80% | 24.55% | 21.88% | NA |
| Temperate Japonica | 767 | 93.00% | 0.10% | 0.13% | 6.78% | NA |
| Tropical Japonica | 504 | 82.90% | 0.20% | 0.79% | 16.07% | NA |
| Japonica Intermediate | 241 | 89.60% | 0.00% | 2.07% | 8.30% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 60.00% | 4.40% | 11.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122327568 | A -> DEL | N | N | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| vg1122327568 | A -> G | LOC_Os11g37759.1 | upstream_gene_variant ; 1399.0bp to feature; MODIFIER | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| vg1122327568 | A -> G | LOC_Os11g37759.3 | upstream_gene_variant ; 1399.0bp to feature; MODIFIER | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| vg1122327568 | A -> G | LOC_Os11g37759.2 | upstream_gene_variant ; 1399.0bp to feature; MODIFIER | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| vg1122327568 | A -> G | LOC_Os11g37750.1 | downstream_gene_variant ; 2579.0bp to feature; MODIFIER | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| vg1122327568 | A -> G | LOC_Os11g37750-LOC_Os11g37759 | intergenic_region ; MODIFIER | silent_mutation | Average:18.32; most accessible tissue: Callus, score: 57.983 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122327568 | NA | 3.27E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122327568 | 4.31E-06 | 3.10E-07 | mr1319 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122327568 | 2.60E-06 | 5.12E-07 | mr1319 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122327568 | 3.89E-06 | NA | mr1531 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122327568 | NA | 7.02E-10 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |