\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122311857:

Variant ID: vg1122311857 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22311857
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGCAATAAATATTTAATTTATCCCTATGAGTAATTATCCGTCCTCATTATTTAGAAAGAAAGGTAGACTTATTTTGTTAAGAAAACATGTCAAACAAAT[T/G]
AAGTGTACATTAAAACTAAGGTGTTATTCTTTTTAGTCGAATGTTTAGGGACTCTTTTTTAGTAAATCATGGAAAACTATTATTACTGTTTTATTTATAC

Reverse complement sequence

GTATAAATAAAACAGTAATAATAGTTTTCCATGATTTACTAAAAAAGAGTCCCTAAACATTCGACTAAAAAGAATAACACCTTAGTTTTAATGTACACTT[A/C]
ATTTGTTTGACATGTTTTCTTAACAAAATAAGTCTACCTTTCTTTCTAAATAATGAGGACGGATAATTACTCATAGGGATAAATTAAATATTTATTGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.90% 0.00% 0.00% NA
All Indica  2759 89.60% 10.40% 0.00% 0.00% NA
All Japonica  1512 95.70% 4.30% 0.00% 0.00% NA
Aus  269 76.60% 23.40% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 80.20% 19.80% 0.00% 0.00% NA
Indica Intermediate  786 88.20% 11.80% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122311857 T -> G LOC_Os11g37730.1 downstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:29.394; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N
vg1122311857 T -> G LOC_Os11g37730.2 downstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:29.394; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N
vg1122311857 T -> G LOC_Os11g37740.1 intron_variant ; MODIFIER silent_mutation Average:29.394; most accessible tissue: Zhenshan97 flower, score: 37.704 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122311857 NA 1.13E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 4.78E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 2.24E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 1.74E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 3.33E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 1.19E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 9.08E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 4.15E-06 7.90E-13 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 3.68E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 1.34E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 2.01E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 4.14E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 2.31E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 7.74E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122311857 NA 5.88E-16 mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251